cd4 t cells with dual tropic hiv 1

Báo cáo y học: "Enrichment of intersubtype HIV-1 recombinants in a dual infection system using HIV-1 strain-specific siRNAs" pps

Báo cáo y học: "Enrichment of intersubtype HIV-1 recombinants in a dual infection system using HIV-1 strain-specific siRNAs" pps

... mutant virus (mutations in the siRNA target sequence) Although siRNAs select for HIV- 1 with mutations in the siRNA target sequence, the selected mutant virus must compete with wild type virus that ... findings it appears that v120-A, even with these siRNA-resistant mutations, was more fit that siRNA-resistant A/D recombinants and obviously more fit than v126-D with any siRNA target site mutations ... HIV- 1 HIV- 1 inhibition by siRNA was greatest at days to with breakthrough starting at day By day 8, virus rebound was apparent, as is the case with monoinfections with v120-A or v126-D treated with...

Ngày tải lên: 13/08/2014, 01:20

12 250 0
The effects of clay a m e n d m e n t and composting on metal speciation in digested sludge liang qiao

The effects of clay a m e n d m e n t and composting on metal speciation in digested sludge liang qiao

... of digested sludge 953 Table I The effect of factoring in the dilution by red mud addition on total metal content in sludge compost and the metal content associated with the silicates Metals (rag ... 397 446 314 400 490 543 430 487 0.8 2.5 2.0 Total Ni 7.3 10 .6 5.2 10 12 13 14 13 2.2 3 .1 3.4 Total Pb 45 43 51 42 47 47 55 46 3.4 4.7 Total Zn 19 6 2 21 1 51 198 222 258 203 2 31 0.8 2 .1 Note: RM % ... five fractions in the sequential extraction 10 4% and moist samples 10 7% It should bt; noted that the total metal content data obtained from the sum of the metal fractions were available for all...

Ngày tải lên: 23/09/2012, 14:47

14 1K 0
Tài liệu Finance and Economics Discussion Series Divisions of Research & Statistics and Monetary Affairs Federal Reserve Board, Washington, D.C.: Interest Rate Risk and Bank Equity Valuations doc

Tài liệu Finance and Economics Discussion Series Divisions of Research & Statistics and Monetary Affairs Federal Reserve Board, Washington, D.C.: Interest Rate Risk and Bank Equity Valuations doc

... repricing/maturity gap Percentage points Percentage points P90 P50 P10 P90 P50 P10 4 3 2 1 0 -1 10 12 14 -1 16 Quarters after the shock 10 12 14 16 Quarters after the shock Note: The left panel depicts the ... According to these data, interest rate swaps account for the vast bulk of the notional amount of interest rate derivative contracts Interest rate options, both exchange traded (ET) and those that trade ... πi ,t k + 1 yt + β2 (yt − yt ) πit = k =1 10y R/M R/M R/M 3m 3m + γ2 GAPi ,t 1 × (yt − yt ) + γ0 GAPi ,t 1 + 1 GAPi ,t 1 × yt (7) 10 y 3m 3m + θ ′ Xi ,t 1 + θ ′ Xi ,t 1 × yt + θ ′ Xi ,t 1 × (yt − yt...

Ngày tải lên: 17/02/2014, 03:20

47 528 1
Tài liệu Báo cáo khoa học: Insights into the structure of plant a-type phospholipase D Susanne Stumpe, Stephan Konig and Renate Ulbrich-Hofmann ¨ ppt

Tài liệu Báo cáo khoa học: Insights into the structure of plant a-type phospholipase D Susanne Stumpe, Stephan Konig and Renate Ulbrich-Hofmann ¨ ppt

... (Table 1) These constants, determined at about 10 -fold lower protein concentration than the measurements of inactivation, show the same trends with respect to the effects of NaCl, CaCl2 and EDTA ... structure at the top of the left view in Fig We speculate that the loosely structured region on the opposite side belongs to the C2 domain (14 1 amino acids) with its extended loops, whereas the ... is more intense [32], the spectrum suggests that b-sheet structures dominate This assumption was confirmed by the calculation of the a-helix and b-strand contents of the protein with the online...

Ngày tải lên: 19/02/2014, 02:20

11 751 0
Báo cáo khoa học: Purification and structural analysis of the novel glycoprotein allergen Cyn d 24, a pathogenesis-related protein PR-1, from Bermuda grass pollen pot

Báo cáo khoa học: Purification and structural analysis of the novel glycoprotein allergen Cyn d 24, a pathogenesis-related protein PR-1, from Bermuda grass pollen pot

... of the protonated peptide at m ⁄ z 16 08.7, which led to the determination of the peptide sequence as EHVPPL ⁄ ITWDTTIL ⁄ IAK, where DTT corresponds to the original N-glycosylation site, NTT As ... characterization was not attempted, but subsequent MS ⁄ MS analysis localized the Fuc at the reducing end, HexNAc, and the results are consistent with a ‘pauci’ mannose structure with core a- (1, 3)-fucosylation, ... extract was brought to 90% saturation with solid ammonium sulfate, stirred slowly for 40 at °C After centrifugation, the supernatant was applied to a Sephadex G-25 column with the break-through material...

Ngày tải lên: 07/03/2014, 12:20

10 665 0
Báo cáo Y học: A polymer with a backbone of 3-deoxy-D-glycero -D-galacto -non-2ulopyranosonic acid, a teichuronic acid, and a b-glucosylated ribitol teichoic acid in the cell wall of plant pathogenic Streptomyces sp. VKM Ac-2124 pdf

Báo cáo Y học: A polymer with a backbone of 3-deoxy-D-glycero -D-galacto -non-2ulopyranosonic acid, a teichuronic acid, and a b-glucosylated ribitol teichoic acid in the cell wall of plant pathogenic Streptomyces sp. VKM Ac-2124 pdf

... of the sequence data with the same software To evaluate the pathogenic activity of the strain, the aseptically cultured potato microtubers in vitro were used as described by Lawrence et al [14 ] ... of plant pathogenic streptomycete (Eur J Biochem 269) 60 21 tree was constructed by the neighbour-joining method [12 ] with CLUSTAL W software [13 ] Three topologies were evaluated by bootstrap analysis ... ISP 523 6T (AY0943 71) formed a tight cluster with a 10 0% bootstrap replication value (not presented), which is significantly distant from other validly described plant pathogenic streptomycete species...

Ngày tải lên: 17/03/2014, 10:20

6 561 0
Future R&D Environments A Report for the National Institute of Standards and Technology potx

Future R&D Environments A Report for the National Institute of Standards and Technology potx

... bloodstream can pass, stimulating the cells to produce proteins or other molecules that can pass back into the bloodstream but not allowing the active constituents of the immune system to reach the ... animals This last objection, or at least the broad public resonance with it, is somewhat mitigated if primates are not the source of the transplants However, it seems at best uncertain, and at worst ... ways to automate the process by allowing monitors that are implanted in the patient or merely connected to implanted sensors to transmit their signals remotely to computers that can record the...

Ngày tải lên: 23/03/2014, 01:20

233 408 0
Asthma WellnessKeeping Children with Asthma in School and Learning Liability & Litigation: A Legal Primer Asthma & Indoor Air Quality (IAQ)Asthma Management, Policies and Procedures.St r a i g h tBy Paul D. Houstont a l kIn School and Healthy: docx

Asthma WellnessKeeping Children with Asthma in School and Learning Liability & Litigation: A Legal Primer Asthma & Indoor Air Quality (IAQ)Asthma Management, Policies and Procedures.St r a i g h tBy Paul D. Houstont a l kIn School and Healthy: docx

... proactive In the event of a lawsuit against the school district, it is important to be able to demonstrate that a school maintained its duty of care to students and staff by responding to complaints, ... reducing the absenteeism of students with asthma, then we know these students will perform better academically Attendance is the key to student achievement." Evaluation of the pilot program showed that ... Our history and observations reveal that this student’s asthma severity has changed (see chart) Severe Persistent Moderate Persistent Mild Persistent Mild Intermittent Days w/symptoms Continual...

Ngày tải lên: 23/03/2014, 23:20

16 450 0
bailin d., love a. cosmology in gauge field theory and string theory

bailin d., love a. cosmology in gauge field theory and string theory

... t0 Copyright © 2004 IOP Publishing Ltd √ dt = R (t) t1 + t1 so that r1 r1 √ t0 dt = R (t) dt = R (t) dr t1 dr − kr dt R (t) t1 + t1 t1 (1. 11) − kr dt R (t) (1. 12) (1. 13) (1. 14) The standard model ... at t = t1 and t = t1 + t1 Equation (1. 3) applies but with appropriate modifications to the limits of integration Thus, t0 t1 and dt = R (t) t0 + t0 t1 + t1 Subtracting gives t0 + t0 t0 + t0 t0 ... equation (1. 34) may be rewritten as ˙ T T 2 = H0 T T0 with solution t= (H0 1/ 2 1 ) T T0 (1. 115 ) −3/2 (1. 116 ) 1. 9 Transition from radiation to matter domination As we have seen in (1. 49) and (1. 50),...

Ngày tải lên: 24/04/2014, 17:06

317 683 0
báo cáo hóa học: " Methyl salicylate 2-O-b-D-lactoside, a novel salicylic acid analogue, acts as an antiinflammatory agent on microglia and astrocytes" docx

báo cáo hóa học: " Methyl salicylate 2-O-b-D-lactoside, a novel salicylic acid analogue, acts as an antiinflammatory agent on microglia and astrocytes" docx

... [13 ,14 ] To investigate the effect of DL0309 on COX -1 enzymatic activity, cells were not treated with LPS in order to express only the COX -1 isoform [15 ] Thus, measured PGE2 levels represent COX -1 ... COX -1 and COX -1 were measured by western blotting To measure total COX activity (COX -1/ 2) (C), cells were stimulated with LPS (0.5 μg/ml) for 24 h After changing the medium, cells were treated with ... astrocytes (Figure 2D), while pretreatment with DL0309 significantly decreased iNOS expression at a concentration of 10 μM These results demonstrate that DL0309 inhibits NO release, at least...

Ngày tải lên: 19/06/2014, 22:20

7 409 0
Báo cáo hóa học: " Research Article Efficient and Precise Processing for Squinted Spotlight SAR Through a Modified Stolt Mapping" doc

Báo cáo hóa học: " Research Article Efficient and Precise Processing for Squinted Spotlight SAR Through a Modified Stolt Mapping" doc

... algorithm but without making any approximations throughout the whole program (12 ) The three terms on the right-hand side of (11 ) represent, respectively, the azimuth modulation, the range migration ... simultaneously through the Stolt mapping in the wave number domain The azimuth modulation is the dominant term in (11 ) and is the main contributor to the shifting and the skewing of the spectrum after the ... of the data spectrum before the Stolt mapping: the two horizontal dotted lines delimit the range bandwidth and the two vertical dotted lines delimit the azimuth bandwidth for a 20◦ squint angle...

Ngày tải lên: 22/06/2014, 23:20

7 268 0
Báo cáo khoa học: "Analysis of growth and light interception of balsam fir and white birch saplings following precommercial thinning D Pothier A" doc

Báo cáo khoa học: "Analysis of growth and light interception of balsam fir and white birch saplings following precommercial thinning D Pothier A" doc

... to nonphotosynthetic tissues (LWR) was not affected by treatment (table I) Neither were there any significant differences in total leaf area between treatments during either of the thinning have ... responded with a greater NAR the first year and a greater LWR the second year Finally, we suggest that the indeterminate growth habit of white birch permitted it to reestablish an equilibrium between ... suggests that their leaves were still more photosynthetically active than controls (Nygren and Kellomäki, 19 83; Oren et al, 19 86) An increase in the allocation of photosynthates to leaf production...

Ngày tải lên: 08/08/2014, 23:21

10 245 0
báo cáo khoa học: " The isolation and mapping of a novel hydroxycinnamoyltransferase in the globe artichoke chlorogenic acid pathway" pptx

báo cáo khoa học: " The isolation and mapping of a novel hydroxycinnamoyltransferase in the globe artichoke chlorogenic acid pathway" pptx

... TCTCATAGGAGCTGTAATTG TAAAATGGACGATCAGTATC TTATGTTCAGATTTGGACTC TACTTTCTACAACGAGCTTC ACATGATTTGAGTCATCTTC GGGTTTCATATGAAGATCGAGGTGAGAGAA CGGGATCCTTAGATATCATATAGGAACTTGC ATATTCACGACGACTCCGATAGCGGTATCG ... CACGTCGGCTTCGACTGTAGGTCGACT CACGAGACCAAGTCAATGCACTCAAAGGA GATTCGGGCACTTAAACGTATGAGCCCC CGTGGACTATCAGACGATCAACCATCC TCGTCCGTCAGTAGCCACGTACAGTATC CACAAAACCAAAACTTCACATCCCATCC CTCACTATGGATTCTCCTAGCGGTGTCG ... HCT-OuterFor HCT-OuterRev HQT-InnerFor HQT-InnerRev HQT-OuterFor HQT-OuterRev AAGCCNWSNAARCC CCCCANCCRAARTC GGGTTTCATATGACTATCGGAGCTCGTGAT CGGGATCCCTAGAAGTCATACAAGCATTT TTTTTAAGCTAACACGAGAC TCTCATAGGAGCTGTAATTG...

Ngày tải lên: 12/08/2014, 03:20

13 650 0
Báo cáo y học: "Mapping of IgE-binding regions on recombinant Cyn d 1, a major allergen from Bermuda Grass Pollen (BGP)" pps

Báo cáo y học: "Mapping of IgE-binding regions on recombinant Cyn d 1, a major allergen from Bermuda Grass Pollen (BGP)" pps

... D120Fwd D170Fwd D224Rev GGTGGCGACGACTCTGGAGCCCG TTGACACCAGACCAACTGGTAATG GTGAGCGGATAACAATTTCACACAG GTTCTGAGGTCATTACTGGATC CCATCCTTAAGCTTGAAGATGGGTTCGTTG GATGAGGACAAGCTTGGGCTCGCCGGAGC CTCCTCTCCAAGCTTCTTCTTGGCCCATGGC ... CTCCTCTCCAAGCTTCTTCTTGGCCCATGGC GCCATCGCCAAGCTTGGCAGCGTACTTCAC GTGAAGTACAGCGCTGCCGGCGATGGCAAC CTGCGCAAGAGCGCTGGCGAACTGATG GCAAGGAGCCCAGCGCTGAGTGCTCCGGC GGCGCATGGAGCGCTATGGGCGACAAGCCG GCATCAATGCAAGCTTTCAGAACTGGATC ... GCATCAATGCAAGCTTTCAGAACTGGATC CTCCTCTCCGGATCCCTTCTTGGCCATGGC GTGAAGTACGCTGGATCCGCCGGCGATGGC GACATCGTCCTGAAGCTTTTCGACATGGCC The sequences of the overlapping fragments of varying lengths covering the entire rCyn...

Ngày tải lên: 13/08/2014, 13:22

12 226 0
Báo cáo sinh học: " SNP mapping of QTL affecting growth and fatness on chicken GGA1" pptx

Báo cáo sinh học: " SNP mapping of QTL affecting growth and fatness on chicken GGA1" pptx

... CTTCCCACCAACGTTCTGTT CCAAAGCTCTGAAAGGCAAG AATTCATCCCTCCAGCACAG CTCTCTGCATGCCTTCACTG ATCCGTGGTTTGGTATTGGA CCACTTTGCTGCAGTCGTTA CACCCAAACAGTCCCATTTT ATTTGCCATGCAGCTTCTTT CCAGCAGTGTTCTCACCTCA CTGGATGATCCTGTGGGTCT ... CTGGATGATCCTGTGGGTCT TCAGGACCGTGGAGTTTTTC CCAGCTGAGACAGTTGGACA GTCCAAATTCCCCCAGAGAT CGGTTGGACTTGGTGATCTT CAATGGAACAGCCTTGAGTG CCAGACTTTGACATGCTGGA AATCCCTCGTTCATGATGGT TAAGCTAGCAGGGCAGTCGT GCTCAGTTTTGGACCTGCTC ... TAGCTGCAGGCGTACAAAGA CCGTGCCCTGTACCTGTAGT AGGCTGAACAGTCCCAGCTA ATATGGGTGTGTGGCCTTGT AAGAAAAGCCGTGTTCTGGA CACTCAGGGCTGTGTCTTGA GAGTGTCCCTCTCCCTTTCC GCTTTTAGCCCACTGTGCAT TAGCTTTGGCATCCTCACCT AGAAATGTGGATGGGAGCAC Annealing...

Ngày tải lên: 14/08/2014, 13:22

14 312 0
Báo cáo y học: "Strict glycaemic control in patients hospitalised in a mixed medical and surgical intensive care unit: a randomised clinical trial"

Báo cáo y học: "Strict glycaemic control in patients hospitalised in a mixed medical and surgical intensive care unit: a randomised clinical trial"

... administered all 504 patients during the first 10 10 days intensive care Nutrition administered toto all 504 patients during the firstdays of of intensive care Feeding at represents the administration ... important increase in severe hypoglycaemia Of note, however, was that it was very difficult to strictly restrict glycaemic control and the study showed that less than 50% of patients were within target ... number not for citation purposes) Results During the study period 16 43 patients were admitted to the ICU and 8 31 did not meet inclusion criteria: 7 91 had an expected length of stay in the ICU...

Ngày tải lên: 25/10/2012, 10:35

9 636 0
Báo cáo y học: "Spinal Intramedullary Cysticercosis: A Case Report and Literature Review"

Báo cáo y học: "Spinal Intramedullary Cysticercosis: A Case Report and Literature Review"

... ambulate without special 4 21 support The function of anal sphincter and bladder regained without compromise of the activities of her daily living However, her hypoesthesia over the T4 dermatome still ... and India19-20 Intramedullary cysticercosis often presents in the patients between 20 to 45 years old, with the youngest one years old and the oldest one 45 year’s old15 Most patients experienced ... However, the results of surgical outcome are mixed Mohanty16 reported only a 75% satisfactory outcome after surgery and cysticidal treatment Early diagnosis and treatment can improve the outcome Outcomes...

Ngày tải lên: 25/10/2012, 10:56

4 592 0
Báo cáo y học: "Mirror-Image Arachnoid Cysts in a Pair of Monozygotic Twins: A Case Report and Review of the Literature"

Báo cáo y học: "Mirror-Image Arachnoid Cysts in a Pair of Monozygotic Twins: A Case Report and Review of the Literature"

... al reported that MZ with discordant handedness showed opposite brain activity patterns in language and a mental rotation task Sommer et al 14 have suggested that late splitting of the egg may ... suggest that the reported incidence rate of mirror-imaging of AC is probably underestimated To improve the diagnosis rate, we consider that it is essential to systematically monitor the counterpart ... counterpart of the symptomatic patient with AC as early as possible, irrespective of the absence of symptoms Conflict of Interest The authors have declared that no conflict of interest exists References...

Ngày tải lên: 25/10/2012, 11:00

4 652 0
Viewing a WSDL File and Testing a Web Service

Viewing a WSDL File and Testing a Web Service

... name="CustomersHttpGet"> ... name="CustomersHttpGet" type="s0:CustomersHttpGet"> ... binding="s0:CustomersHttpGet">

Ngày tải lên: 24/10/2013, 12:15

7 382 0
Configuring a Stub Area and a Totally Stubby Area

Configuring a Stub Area and a Totally Stubby Area

... 19 2 .16 8.96 .1 [11 0/66] via 19 2 .16 8.208 .1, 00: 01: 01, Serial0/0 19 2 .16 8 .11 2.0/32 is subnetted, subnets 19 2 .16 8 .11 2 .1 [11 0/66] via 19 2 .16 8.208 .1, 00: 01: 02, Serial0/0 19 2 .16 8.220.0/24 is directly connected, ... FastEthernet0/0 19 2 .16 8.80.0/32 is subnetted, subnets 19 2 .16 8.80 .1 [11 0/66] via 19 2 .16 8.208 .1, 00:20:04, Serial0/0 19 2 .16 8.96.0/32 is subnetted, subnets 19 2 .16 8.96 .1 [11 0/66] via 19 2 .16 8.208 .1, ... 19 2 .16 8. 216 .0/24 is directly connected, FastEthernet0/0 19 2 .16 8.80.0/32 is subnetted, subnets 19 2 .16 8.80 .1 [11 0/66] via 19 2 .16 8.208 .1, 00: 01: 01, Serial0/0 19 2 .16 8.96.0/32 is subnetted, subnets 19 2 .16 8.96.1...

Ngày tải lên: 27/10/2013, 08:15

5 361 0
w