cd4 t cell lymphopenia a biomarker for immunosuppression associated complications

Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot

Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot

Ngày tải lên : 13/08/2014, 01:20
... member KLRD1L gtgggagaatggctctgc KLRD1R tttgtattaaaagtttcaaatgatgga BDLvsLTNP CD8 2.5 2.1 IRS2 NM_003749.2 insulin receptor substrate IRS2L tgacttcttgtcccaccactt IRS2R catcctggtgataaagccaga CD8 3.8 ... ACTA2L ctgttccagccatccttcat ACTA2R tcatgatgctgttgtaggtggt BDLvsVIR CD8 -1.3 -2.2 ATP6V1D NM_015994.2 ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D ATP6V1DL ttttcactagctgaagccaagtt ATP6V1DR ... gcgctttattgacattttggat VIRvsLTNP CD8 2.0 2.8 BAG3 cagccagataaacagtgtggac BAG3R agaggcagctggagactgg VIRvsLTNP CD8 -1.5 Wu et al Retrovirology 2011, 8:18 http://www.retrovirology.com/content/8/1/18...
  • 21
  • 376
  • 0
báo cáo hóa học:" Regulatory activity of azabisphosphonate-capped dendrimers on human CD4+ T cell proliferation enhances ex-vivo expansion of NK cells from PBMCs for immunotherapy" potx

báo cáo hóa học:" Regulatory activity of azabisphosphonate-capped dendrimers on human CD4+ T cell proliferation enhances ex-vivo expansion of NK cells from PBMCs for immunotherapy" potx

Ngày tải lên : 18/06/2014, 15:20
... experiments revealed that the parental 3a- G1 was able to shift the apparent dissociation constant (Kapp) of 3a- G1-Julo without affecting Bmax (Fig 5b), and vice versa (data not shown), meaning that ... that 3a- G1 doesn 't affect their cytotoxicity when compared with untreated cells [see Additional file 1] Contrary to expectation, we could not demonstrate any significant activation of proliferation ... stimulated proliferation of autologous NK cells is not affected Cell cycle analysis shows that the decrease of proliferation of 3a- G1 treated CD4+ T cells correlates with a reduction of mitotic...
  • 13
  • 404
  • 0
Báo cáo sinh học: "Generalized immune activation as a direct result of activated CD4+ T cell killing" doc

Báo cáo sinh học: "Generalized immune activation as a direct result of activated CD4+ T cell killing" doc

Ngày tải lên : 06/08/2014, 19:21
... similar to the lifespan of activated CD4+ T cells in Tnfrsf4Cre/+ R26Dta/+ mice (there is about a 48 hour interval between T cell activation and DTA-mediated death) It has been postulated that HIV ... possible that the high natural turnover of activated CD4+ T cells masks virus-induced death Alternatively, the apparent ‘resistance’ of activated CD4+ T cells during chronic HIV infection may represent ... potential for DTA-mediated death upon CD4+ T cell activation in Tnfrsf4Cre/+ R26Dta/+ mice had surprisingly little effect on memory CD4+ T cell survival and homeostasis The reasons for this apparent...
  • 18
  • 244
  • 0
Báo cáo y học: "Comparison of capillary based microflurometric assay for CD4+ T cell count estimation with dual platform Flow cytometr" pps

Báo cáo y học: "Comparison of capillary based microflurometric assay for CD4+ T cell count estimation with dual platform Flow cytometr" pps

Ngày tải lên : 10/08/2014, 05:20
... estimated by calculating the kappa factor The Bland-Altman plots were generated for assessment of the variation between the two methods The sensitivity and specificity of the Easy CD4 assay was ... 1000 Average CD4 by two methods Figure obtained by Easy CD4 assay the CD4+ cell counts Bland Altman plot analysis of(Guava) andTflow cytometry Bland Altman plot analysis of the CD4+ T cell counts ... counts obtained by Easy CD4 assay (Guava) and flow cytometry Bland-Altman plot comparing absolute CD4 cell counts estimated by Guava EasyCD4 assay and conventional flowcytometry The dark continuous...
  • 7
  • 462
  • 0
Báo cáo y học: "Expression and reactivation of HIV in a chemokine induced model of HIV latency in primary resting CD4+ T cell" potx

Báo cáo y học: "Expression and reactivation of HIV in a chemokine induced model of HIV latency in primary resting CD4+ T cell" potx

Ngày tải lên : 13/08/2014, 01:21
... SB407 1st rd reverse Alu 5' -TGCTGGGATTACAGGCGTGAG-3' SL75 2nd rd forward 5' -GGAACCCACTGCTTAAGCCTC-3' SL76 2nd rd reverse 5' -GTCTGAGGGATCTCTAGTTACC-3' SL72 beacon FAM-CGGTCGAGTGCTTCAAGTAGTGTGTGCCCGTC ... CGCACGGCAAGAGGCAGG-3' 0dp 2138 US reverse 5' CCCGCTTAATACCGACGCTCTCG-3' 0dp 2140 MS reverse 5' GTCGGGTCCCCTCGGGATTGG-3' 0dp 2139 SS reverse 5' AGGTTGCATTACATGTACTACTTACTGCTT-3' LTR=long terminal ... SL28 MS Forward 5' - CTTAGGCATCTCCTATGGCAGGAA - 3' SL29 MS reverse 5' - TTCCTTCGGGCCTGTCGGGTCCC - 3' SL38 MS RNA beacon 5' GGGCCT TCTCTATCAAAGCAACCCACCTCC AGGCCC -3' 0dp 2137 Universal forward 5'...
  • 31
  • 268
  • 0
Báo cáo y học: "Human cyclin T1 expression ameliorates a T-cell-specific transcriptional limitation for HIV in transgenic rats, but is not sufficient for a spreading infection of prototypic R5 " ppt

Báo cáo y học: "Human cyclin T1 expression ameliorates a T-cell-specific transcriptional limitation for HIV in transgenic rats, but is not sufficient for a spreading infection of prototypic R5 " ppt

Ngày tải lên : 13/08/2014, 05:21
... characterization of such an adapted strain could greatly facilitate the identification of host determinants that are critical regulators of late phase-steps of HIV replication Methods Animals The ... Founders for hCycT1-tg rats were identified by PCR amplification of a hCycT1-specific sequence in tail biopsy DNA samples (5'primer: GAT ACT AGA AGT GAG GCT TAT TTG, 3'-primer: CAG ATA GTC ACT ATA AGG ... macrophages from n-tg rats are at a level comparable to human MDM This may, in part, relate to the ability of HIV-1 to exploit a distinct set of nuclear transcription factors and alternative mechanisms...
  • 19
  • 263
  • 0
báo cáo hóa học:" Metabolic and anthropometric parameters contribute to ART-mediated CD4+ T cell recovery in HIV-1-infected individuals: an observational study" potx

báo cáo hóa học:" Metabolic and anthropometric parameters contribute to ART-mediated CD4+ T cell recovery in HIV-1-infected individuals: an observational study" potx

Ngày tải lên : 20/06/2014, 08:20
... responsible for study design, data management, data analysis, and manuscript and illustration preparation ASF supervised the statistical analysis, and contributed to data discussion and manuscript preparation ... Isotype-matched control antibodies were used as negative controls for gate positioning Statistical analysis Summary statistics (mean, standard deviation, median, and max) are reported for each ... CD4 counts) is associated with chronic inflammation and increased immune activation, with alteration of metabolic parameters associated with lipid metabolism and increased atherogenic risk (as...
  • 9
  • 469
  • 0
Báo cáo y học: "Apoptotic cell-mediated suppression of streptococcal cell wall-induced arthritis is associated with alteration of macrophage function and local regulatory T-cell increase: a potential cell-based therapy" ppsx

Báo cáo y học: "Apoptotic cell-mediated suppression of streptococcal cell wall-induced arthritis is associated with alteration of macrophage function and local regulatory T-cell increase: a potential cell-based therapy" ppsx

Ngày tải lên : 09/08/2014, 14:22
... specific pathogen-free rodent facility at the National Institute of Dental and Craniofacial Research, National Institutes of Health All animal studies were performed according to National Institutes ... (Biowhittaker) containing 1% BSA (Irvine, Santa Ana, CA, USA) For surface staining, cells were incubated with FITC-conjugated anti-rat CD4 (Caltag, San Francisco, CA, USA) and allophycoyanin-conjugated ... instructions Statistical analysis Group comparisons of parametric data were made by Student's t test We used the Mann-Whitney rank-sum test for nonparametric data We assessed score comparisons between...
  • 8
  • 310
  • 0
Báo cáo y học: "Immune restoration disease and changes in CD4+ T-cell count in HIV- infected patients during highly active antiretroviral therapy at Zewditu" ppsx

Báo cáo y học: "Immune restoration disease and changes in CD4+ T-cell count in HIV- infected patients during highly active antiretroviral therapy at Zewditu" ppsx

Ngày tải lên : 10/08/2014, 05:21
... 0.05) The interval between the start of HAART and the onset of Table Baseline characteristics of study subjects at Zewditu Memorial Hospital, Addis Ababa, Ethiopia Characteristic Patients with IRD ... AST, ALT and ALP respectively compared to the values at the initiation of HAART (P < 0.001) At nine months after initiation of HAART, both IRD (73%) and non IRD (27.4%) patients had a third CD4+ ... 2005 and August 31, 2006 and who were naive to antiretroviral-treatment at the time they started HAART were retrospectively recruited Patients who did not have adherence to HAART, who had previous...
  • 7
  • 332
  • 0
Báo cáo y học: "NO2 inhalation induces maturation of pulmonary CD11c+ cells that promote antigen­specific CD4+ T cell polarization" pot

Báo cáo y học: "NO2 inhalation induces maturation of pulmonary CD11c+ cells that promote antigen­specific CD4+ T cell polarization" pot

Ngày tải lên : 12/08/2014, 11:22
... cells and uptake of ova-Alexa 647 Data were analyzed by two-tailed unpaired Student’s t test or by two-way ANOVA with Bonferroni post test Statistical calculations were performed using GraphPad ... to capture antigen and travel to the mediastinal lymph node DCs are particularly well-equipped for activating T cells as they are capable of capturing and processing antigens, travelling to the ... respiratory health, the development of asthma, the balance between inhalational tolerance and allergy, and potentially provide mechanistic targets for prevention or treatment Hodgkins et al Respiratory...
  • 18
  • 234
  • 0
Báo cáo y học: "trong mucosal immune responses in SIV infected macaques contribute to viral control and preserved CD4+ T-cell levels in blood and mucosal tissues" pps

Báo cáo y học: "trong mucosal immune responses in SIV infected macaques contribute to viral control and preserved CD4+ T-cell levels in blood and mucosal tissues" pps

Ngày tải lên : 13/08/2014, 01:20
... designed and coordinated the study and edited the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests Received: ... including the plasma viral load, we used the individual viral RNA copy numbers per ml plasma of each animal at the respective point in time when the assay was performed Additional material Additional ... progressors and uninfected animals after polyclonal stimulation Percentage of polyfunctional cells and total cytokine secreting cells after SEB stimulation in the CD4+ memory T- cell subset of PBMC (A) and...
  • 13
  • 253
  • 0
Báo cáo y học: "Distinct roles of CD4+ T cell subpopulations in retroviral immunity: lessons from the Friend virus mouse model" pptx

Báo cáo y học: "Distinct roles of CD4+ T cell subpopulations in retroviral immunity: lessons from the Friend virus mouse model" pptx

Ngày tải lên : 13/08/2014, 01:21
... help and secreting antiviral factors, it has also been shown that CD4 + T cells can develop the capacity to lyse infected cells Although most data come from cell lines and CD4+ T cell clones, it ... activation of immune cells can cause activation-induced cell death and contribute to HIV -associated CD4+ T cell depletion This dysregulation of the immune response not only reduces the ability ... inducing protection against FV was confirmed using a live attenuated FV vaccine Nonpathogenic F-MuLV, which replicates poorly in adult mice, was used as attenuated vaccine Further attenuation of the...
  • 12
  • 264
  • 0
Báo cáo y học: "Mechanisms of HIV non-progression; robust and sustained CD4+ T-cell proliferative responses to p24 antigen correlate with control of viraemia and lack of disease progression after long-term transfusion-acquired HIV-1 infection" pdf

Báo cáo y học: "Mechanisms of HIV non-progression; robust and sustained CD4+ T-cell proliferative responses to p24 antigen correlate with control of viraemia and lack of disease progression after long-term transfusion-acquired HIV-1 infection" pdf

Ngày tải lên : 13/08/2014, 05:21
... 5'-TACTGTATCATCTGCTCCTGTAT-3' (outer, antisense), And 5'-TCTGCTCCTGTATCTAATAGAGCTT-3' antisense) (inner, Both primary and secondary PCR reactions contained units of Taq DNA polymerase (Promega, ... remained asymptomatic for 27 years since infection without antiretroviral therapy; some maintaining plasma HIV RNA levels to below detectable levels and a stable CD4 T cell count, thus retaining elite ... intermittently detected at earlier time points in C122, with sharp increases in Gag CTL temporally associated with control of transient viraemia at 17 years post infection However, Gag CTL later failed...
  • 14
  • 253
  • 0
Báo cáo y học: " Reduced CD4 T cell activation and in vitro susceptibility to HIV-1 infection in exposed uninfected Central Africans" pptx

Báo cáo y học: " Reduced CD4 T cell activation and in vitro susceptibility to HIV-1 infection in exposed uninfected Central Africans" pptx

Ngày tải lên : 13/08/2014, 09:20
... commercial ELISA kits according to the manufacturer's instructions (Quantikine R&D Systems, Oxon, UK) Statistical analysis Statistical analysis was performed by using the STATA 8.0 statistical package ... CCR5-expressing CD4 T cells may actually contribute to protect Central African EUs from HIV-1 transmission A recent study has also associated lower levels of CD4 T cell activation with resistance to HIV-1 ... of T cell activation markers, with a stronger effect on CD8 than on CD4 T cell activation [4,5] A pattern of immune activation, including an increase of activated T cell subsets and of the HIV-1...
  • 9
  • 238
  • 0
Báo cáo y học: " HIV-1 infection and CD4 T cell depletion in the humanized Rag2-/-γc-/- (RAG-hu) mouse model" docx

Báo cáo y học: " HIV-1 infection and CD4 T cell depletion in the humanized Rag2-/-γc-/- (RAG-hu) mouse model" docx

Ngày tải lên : 13/08/2014, 09:20
... stained with antibodies against the human panleukocyte marker CD45 at 12 weeks postengraftment (B) Cells stained with antibodies against the T cell markers CD3 and CD4 (C) Cells stained with antibodies ... foreign grafts Intravenous administration of human hematopoietic stem cells together with exogenous administration of human cytokines leads to a better engraftment rate A recent breakthrough of ... for all the mice at this time as some mice were infected at a later date than the initial set Although considerable variability was present in the level of human cell engraftment in individual...
  • 14
  • 216
  • 0
Báo cáo y học: "Down-regulation of kallikrein-related peptidase 5 (KLK5) expression in breast cancer patients: a biomarker for the differential diagnosis of breast lesions" doc

Báo cáo y học: "Down-regulation of kallikrein-related peptidase 5 (KLK5) expression in breast cancer patients: a biomarker for the differential diagnosis of breast lesions" doc

Ngày tải lên : 13/08/2014, 13:20
... whereas the use of the HPRT1 forward 5’TGGAAAGGGTGTTTATTCCTCAT-3’ and reverse 5’-ATGTAATCCAGCAGGTCAGCAA-3’ primers led to the accumulation of a specific 151bp product The final 10 μL reaction ... the statistical analysis and drafted the manuscript GP participated in the conception and design of the study and the acquisition, the analysis and the interpretation of the data AP participated ... in the conception and design of the study and the acquisition of the data AS participated in the conception and design of the study, the analysis and the interpretation of the data, the statistical...
  • 12
  • 340
  • 0
Báo cáo y học: " T-cell activation promotes tumorigenesis in inflammation-associated cancer" potx

Báo cáo y học: " T-cell activation promotes tumorigenesis in inflammation-associated cancer" potx

Ngày tải lên : 12/08/2014, 23:22
... 4C) These results demonstrate that OA in CFA is sufficient to activate basal HTLV LTR transcriptional activity, which is further activated by induction Page of 10 (page number not for citation ... the cell wall of gram negative bacteria, that rapidly activates pyrogenic cytokines and cells involved in innate immunity [34] In the tumors that arise in TAX-LUC animals, the malignant cells are ... Orba Y, Sheehy N, Yamamoto Y, Ichinohe T, Tsunetsugu-Yokota Y, Katano H, Takahashi H, Matsuda J, Sata T, Kurata T, Nagashima K, Hall WW: Thymus-derived leukemia-lymphoma in mice transgenic for the...
  • 10
  • 217
  • 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

Ngày tải lên : 18/06/2014, 16:20
... is the identification of those antigens that are the most relevant as targets, as the human auto-antigen-specific T cell repertoire is diverse and the optimal antigen target could vary between ... facilitate hematopoietic stem cell transplantation (HSCT) Studies in such patients indicate that Treg cells increase in response to the treatment, and that this effect seems to be increased with prolonged ... counterparts localized in the target organ In this latter regard, there is experimental evidence that the blood carries at least a fraction of those cells with undeniable pathogenic potential As...
  • 12
  • 573
  • 0
báo cáo hóa học: " Persistently elevated T cell interferon-γ responses after treatment for latent tuberculosis infection among health care workers in India: a preliminary report" pot

báo cáo hóa học: " Persistently elevated T cell interferon-γ responses after treatment for latent tuberculosis infection among health care workers in India: a preliminary report" pot

Ngày tải lên : 20/06/2014, 00:20
... with smear-positive TB patients at baseline, during and after LTBI treatment All participants were TST and QFT-G positive at baseline (in 2004), and all had completed INH treatment with good adherence ... baseline, of the 726 HCWs, 68% reported having had at least one direct contact with a patient with TB (direct contact was defined as contact between two people that is of sufficient distance to allow ... Gold® (Cellestis Ltd, Carnegie, Australia) assay The QuantiFERON®-TB Gold (QFT-G) assay is available in two formats, a 24-well culture plate format (approved by the US Food and Drug Administration...
  • 7
  • 492
  • 0
Báo cáo y học: "Insights into spatial configuration of a galactosylated epitope required to trigger arthritogenic T-cell receptors specific for the sugar moiety" ppsx

Báo cáo y học: "Insights into spatial configuration of a galactosylated epitope required to trigger arthritogenic T-cell receptors specific for the sugar moiety" ppsx

Ngày tải lên : 09/08/2014, 10:21
... competing interests the collaboration of the staff of the Central Cytometry Laboratory in the Cochin Institute This work was supported by institutional grants from Institut National de la Santé et ... position participates in electrostatic interactions with negatively charged residues of the TCR Alternatively, the ε-amino group can help to render the galactose spatial configuration suitable for TCR ... hybridoma and A9 .2 clone (not shown) The relative position of the elements within Gal-Hyl264 interacting with the TCRs is essential for T- cell activation Having established that both galactose HO-4 and...
  • 9
  • 318
  • 0