cd4 and cd8 t cell activity and polyfunctionality

Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot

Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot

Ngày tải lên : 13/08/2014, 01:20
... muscle, aorta ACTA2L ctgttccagccatccttcat ACTA2R tcatgatgctgttgtaggtggt VIRvsLTNP CD8 4.3 2.8 PSMB2 NM_002794.3 proteasome subunit, beta type, PSMB2L agagggcagtggaactcctt PSMB2R gaaggttggcagattcagga ... V1 subunit D ATP6V1DL ttttcactagctgaagccaagtt ATP6V1DR gcgctttattgacattttggat VIRvsLTNP CD8 2.0 2.8 BAG3 cagccagataaacagtgtggac BAG3R agaggcagctggagactgg VIRvsLTNP CD8 -1.5 Wu et al Retrovirology ... C1QCL aaggatgggtacgacggact C1QCR ttctgccctttgggtcct VIRvsLTNP CD4 7.3 4.4 SERPING1L ctccttacccaggtcctgct SERPING1R ggatgctctccaggtttgtt VIRvsLTNP CD4 5.3 2.8 SERPING1 NM_000062.2 serpin peptidase...
  • 21
  • 376
  • 0
Báo cáo hóa học: "Comparison of anti-CD3 and anti-CD28-coated beads with soluble anti-CD3 for expanding human T cells: Differing impact on CD8 T cell phenotype and responsiveness to restimulation" pot

Báo cáo hóa học: "Comparison of anti-CD3 and anti-CD28-coated beads with soluble anti-CD3 for expanding human T cells: Differing impact on CD8 T cell phenotype and responsiveness to restimulation" pot

Ngày tải lên : 18/06/2014, 16:20
... interrelationship between the type and timing of the second stimulus and expansion of restimulated CD4 (A and B) and CD8 (C and D) T cells To normalize for the impact of persistent growth attributable ... (data not shown) Effector T cells typically produce intracellular cytokines within hours after stimulation in vitro [22], but the CD27+ anti-CD3-expanded CD8 cells (in contrast with the CD27- cells ... stimulated cells/expansion by matched control cells and plotted this as a function of the time interval between first and second stimulation (Figure 8A-D) These plots make two important points...
  • 15
  • 503
  • 0
Báo cáo hóa học: "Programmed cell death-1 (PD-1) at the heart of heterologous prime-boost vaccines and regulation of CD8+ T cell immunity" doc

Báo cáo hóa học: "Programmed cell death-1 (PD-1) at the heart of heterologous prime-boost vaccines and regulation of CD8+ T cell immunity" doc

Ngày tải lên : 18/06/2014, 16:20
... deleterious anti-vector immunity The priming strategy could then be matched with heterologous vectors that expand and/ or differentiate the primed cells to therapeutically useful effector T cells ... with a DNA vaccine result in CD8 + T cells that are more resilient to negative regulatory mechanisms that would otherwise impose restrictions on the expansion and activity of this key subset ... antigen exposure and other factors •Limited antigen exposure, with potent co-stimulation could lead to T cells that retain low PD-1 expression through various stages: recently activated, effector...
  • 11
  • 505
  • 0
Báo cáo y học: "Association between regulatory T cell activity and sepsis and outcome of severely burned patients: a prospective, observational study" doc

Báo cáo y học: "Association between regulatory T cell activity and sepsis and outcome of severely burned patients: a prospective, observational study" doc

Ngày tải lên : 13/08/2014, 20:21
... of Tregs among patients with various burn sizes Taken together, these data suggest that acute insults can induce or amplify CD4+ CD25+ Tregs function and that CD4+ CD25+ T cells contribute to the ... due to injury-induced CD4+ T cell activation However, we demonstrate here that the increased percentage of circulating Tregs in our burned patients was attributable to both T cell activation and ... related to their ability to interact with components of the innate and adaptive immune response, and to their potentiality to be activated nonspecifically by bacterial products and/ or cytokines,...
  • 10
  • 347
  • 0
Immunodominance and immunoprotection of anti viral specific CD8+ t cell response during HBV infection

Immunodominance and immunoprotection of anti viral specific CD8+ t cell response during HBV infection

Ngày tải lên : 10/09/2015, 08:26
... surprisingly, the little stimulatory efficiency of HLA-A203+ targets was completely lost after the 12 h dissociation period (Figure 7) It is interesting to note that the peptide presentation data recapitulate ... help prevented the proper maturation and subsequent functioning of the CD8 T- cells Clearly, these Background studies support the necessity of a functional and coordinated CD8 and CD4 T cell response ... of them clearly affects the expansion and protective efficacy of the other A lack of CD4 T cell help can impair CD8 T cell activity and antibody production 39 , while the inability to mount a...
  • 108
  • 336
  • 0
báo cáo hóa học:" Protective CD8+ T-cell responses to cytomegalovirus driven by rAAV/GFP/IE1 loading of dendritic cells" pdf

báo cáo hóa học:" Protective CD8+ T-cell responses to cytomegalovirus driven by rAAV/GFP/IE1 loading of dendritic cells" pdf

Ngày tải lên : 18/06/2014, 15:20
... http://www.translational-medicine.com/content/6/1/56 Competing interests The authors declare that they have no competing interests Authors' contributions YY performed protein and AAV generation and all PCR experiments and drafted the ... autologous target cells These data are consistent with a strong antigen-specific CTL response Figure shows that CTL killing activity was dose-dependent and MHC class I restricted In this experiment, ... revised and drafted the manuscript MC participated in study design and coordination and revised and drafted the manuscript AM participated in the design of the study and revised and drafted the manuscript...
  • 8
  • 451
  • 0
Báo cáo sinh học: "Differentiation associated regulation of microRNA expression in vivo in human CD8+ T cell subsets" doc

Báo cáo sinh học: "Differentiation associated regulation of microRNA expression in vivo in human CD8+ T cell subsets" doc

Ngày tải lên : 18/06/2014, 19:20
... regulated concomitantly, indicating a differential intra-cluster regulation in agreement with the TLDA results (Table 1) Altogether, the data presented here demonstrate for the first time that human ... + T cell differentiation, and might shed light on the relationship between differentiation and functional properties In that respect, it might therefore be helpful to elaborate better vaccination ... in differentiated CD8+ T cell subsets, and compared to the levels found in naïve cells In agreement with the TLDA data, and despite a relatively important inter-donor variability, the expression...
  • 8
  • 399
  • 0
Báo cáo hóa học: " Impairment of the CD8+ T cell response in lungs following infection with human respiratory syncytial virus is specific to the anatomical site rather than the virus, antigen, or route of infection" pdf

Báo cáo hóa học: " Impairment of the CD8+ T cell response in lungs following infection with human respiratory syncytial virus is specific to the anatomical site rather than the virus, antigen, or route of infection" pdf

Ngày tải lên : 20/06/2014, 01:20
... rather the pulmonary site of residence of the cells Therefore, the conclusion that RSV infection specifically impairs CD8+ CTL functionality [1], and the hypothesis that this might contribute to ... data of flow cytometry analysis of tetramer/pentamer +CD8+ and IFNγ +CD8+ cells from the lungs and Examples of primary data of flow cytometry analysis of tetramer/pentamer +CD8+ and IFNγ +CD8+ cells ... percentage of total PMC or SMC (not shown) These findings are consistent with a recent study demonstrating that, after a highly localized infection with VV by tail scarification, part of the activated...
  • 8
  • 381
  • 0
báo cáo hóa học:" Differentiation associated regulation of microRNA expression in vivo in human CD8+ T cell subsets" pptx

báo cáo hóa học:" Differentiation associated regulation of microRNA expression in vivo in human CD8+ T cell subsets" pptx

Ngày tải lên : 20/06/2014, 03:20
... regulated concomitantly, indicating a differential intra-cluster regulation in agreement with the TLDA results (Table 1) Altogether, the data presented here demonstrate for the first time that human ... + T cell differentiation, and might shed light on the relationship between differentiation and functional properties In that respect, it might therefore be helpful to elaborate better vaccination ... in differentiated CD8+ T cell subsets, and compared to the levels found in naïve cells In agreement with the TLDA data, and despite a relatively important inter-donor variability, the expression...
  • 8
  • 326
  • 0
Báo cáo y học: "Defective CD4+CD25+ regulatory T cell functioning in collagen-induced arthritis: an important factor in pathogenesis, counter-regulated by endogenous IFN-γ" potx

Báo cáo y học: "Defective CD4+CD25+ regulatory T cell functioning in collagen-induced arthritis: an important factor in pathogenesis, counter-regulated by endogenous IFN-γ" potx

Ngày tải lên : 09/08/2014, 06:22
... AAC CTT; Foxp3-RV, TTC TCA CAA CCA GGC CAC TTG; Foxp3-TP, ATC CTA CCC ACT GCT GGC AAA TGG AGT C; TGF-β-FW, TGA CGT CAC TGG AGT TGT ACG G; TGF-β-RV, GGT TCA TGT CAT GGA TGG TGC; TGFβ-TP, TTC AGC ... [3H]TdR and harvested The suppressive activity of the Treg cells can be presented by plotting the percentage of inhibition (100 × (Radioactivity in condition without Treg cells – Radioactivity ... condition without Treg cells – Radioactivity in condition with Treg cells)/Radioactivity in condition without Treg cells) of the proliferation of Teff cells (CD4+ CD25-) by increasing numbers of CD4+ CD25+...
  • 14
  • 403
  • 0
Báo cáo y học: " The intracellular detection of MIP-1beta enhances the capacity to detect IFN-gamma mediated HIV-1-specific CD8 T-cell responses in a flow cytometric setting pro" ppsx

Báo cáo y học: " The intracellular detection of MIP-1beta enhances the capacity to detect IFN-gamma mediated HIV-1-specific CD8 T-cell responses in a flow cytometric setting pro" ppsx

Ngày tải lên : 10/08/2014, 05:21
... http://www.aidsrestherapy.com/content/5/1/22 CD8 T- cells The assay has the capacity to detect the cytokines IFN-γ and IL-2, the chemokine MIP-1β and the activation marker CD154 For the characterization ... eval- uation of the total IFN-γ+ T- cells As expected, the simultaneous detection of IFN-γ+ and MIP-1β+ did not increase the capacity to detect antigen-specific CD4 T- cell responses In fact, 11 CD4 ... evaluation equivalent to the measurement of the total IFN-γ producing T- cells with the relevant advantage of a consistent decrease of the background that in turn increases the sensitivity of the...
  • 13
  • 379
  • 0
Báo cáo y học: " Characteristics of CD8+ T cell subsets in Chinese patients with chronic HIV infection during initial ART" doc

Báo cáo y học: " Characteristics of CD8+ T cell subsets in Chinese patients with chronic HIV infection during initial ART" doc

Ngày tải lên : 10/08/2014, 05:22
... active antiretroviral therapy results in a decrease in CD8+ T cell activation and preferential reconstitution of the peripheral CD4+ T cell population with memory rather than naive cells Antiviral ... manuscript and statistical analyses WH participated in flow cytometric analysis TZ followed up patients and collected samples YZ assisted with manuscript and data anlysis YJ assisted with flow cytometric ... The total CD8+ T cells had a tendency of decrease (see figure 2) Of the subsets we studied, EMRA and EM subsets declined in consistent with total CD8+ T cells, while the naïve and CM subsets had...
  • 7
  • 338
  • 0
Báo cáo y học: "Escape is a more common mechanism than avidity reduction for evasion of CD8+ T cell responses in primary human" pdf

Báo cáo y học: "Escape is a more common mechanism than avidity reduction for evasion of CD8+ T cell responses in primary human" pdf

Ngày tải lên : 13/08/2014, 01:20
... RPQVPLRPMTY RPQVPLRPMTY d415 RPQVPLRPMTY HLA-A2 YTAFTIPSI (RT 71-81) 127-135) YTAFTIPSI YTAFTIPSI /T YTAFTIPST YTAFTIPST 127-135) d28 YTAFTIPSV d53 YTAFTIPSV d81 YTAFTIPSV d299 YTAFTIPSV/I d9 AAVDLSHFLK ... of these cases it appeared that an escape mutation had been transmitted that then reverted, stimulating expansion of T cells able to recognise the original epitope with higher avidity than the ... better than lower avidity T cells at any given antigen density [23] In vitro studies also suggest that HIVspecific CD8+ T cells must exceed an epitope-dependent avidity threshold in order to...
  • 13
  • 370
  • 0
Báo cáo y học: "Viral suppression of multiple escape mutants by de novo CD8+ T cell responses in a human immunodeficiency virus-1 Infected elite suppressor" ppt

Báo cáo y học: "Viral suppression of multiple escape mutants by de novo CD8+ T cell responses in a human immunodeficiency virus-1 Infected elite suppressor" ppt

Ngày tải lên : 13/08/2014, 01:21
... to wild type TW10 peptide, but not to autologous variants Representative dot plot and histogram shown for stimulation with one of the autologous mutants, TSTLTEQVAW (top left) and wild type TW10 ... infected PHA activated CD4+ T cells from ES8 with the replication competent viruses constructed to express these TW10 variants, and co-cultured the infected cells with each CD8+ T cell population that ... variants cultured from activated CD4 + T cells and resting CD4 + T cells from the patient, respectively [18] The ES8-1A variant expresses mutant IW9 and TW10 epitopes, specifically the TSTLAEQVAW...
  • 7
  • 273
  • 0
Báo cáo y học: " T cell activity in successful treatment of chronic urticaria with omalizumab" pdf

Báo cáo y học: " T cell activity in successful treatment of chronic urticaria with omalizumab" pdf

Ngày tải lên : 13/08/2014, 13:22
... postulated the assessment of PHAstimulated adenosine triphosphate (ATP) activity as maker of CD4+ T cells activity in peripheral blood cells [11] We evaluated the effects of omalizumab therapy and ... added to immunoselect CD4 cells from both the stimulated and non-stimulated cells After washing the selected CD4 cells on a magnet tray, a hypotonic basic solution as lysis reagent was added to ... asymptomatic without any side effects Further, we tried to extend it to weeks, but resulting with small hives in patient’s extremities In parallel, whole blood was obtained before each administration...
  • 3
  • 232
  • 1
Báo cáo sinh học: " A combined nucleocapsid vaccine induces vigorous SARS-CD8+ T-cell immune responses" potx

Báo cáo sinh học: " A combined nucleocapsid vaccine induces vigorous SARS-CD8+ T-cell immune responses" potx

Ngày tải lên : 14/08/2014, 19:22
... 5'-ggatccatgtctgataatggaccc-3'; reverse primer: 5'-gaattcttatgcctgagttgaatc-3') The amplicon was purified using the QIAquick gel extraction kit (Qiagen) and cloned into the PCR 2.1 TOPO-TA vector ... neither the mock-transfected cells nor the cells transfected with the vector alone showed viral-like particles (Fig 2) These observations demonstrate that our construct expressing the NC protein ... the most frequently used experimental adjuvants; this adjuvant stimulates dendritic cells through Toll-like receptor (TLR9), inducing cell maturation and enhancing antigen presentation and Th1 responses...
  • 10
  • 160
  • 0
The role of interferon gamma in regulating antigen specific CD8 t cell responses in a mouse model of influenza

The role of interferon gamma in regulating antigen specific CD8 t cell responses in a mouse model of influenza

Ngày tải lên : 10/09/2015, 09:25
... surface of the virus HA is a lectin that mediates the binding of the virus to target cells and facilitates the entry of the virus into the target cell The proteolytic cleavage of the HA molecule ... infection is to provide T cell help to augment B cell antibody production and CD8+ T cell cytolysis of infected cells to clear the virus from the respiratory tract Different subsets of Th cells ... CD8+ T cells rather than their proliferation may be attributed to IL-7 IL-15 on the other hand is a more potent proliferative agent for memory CD8+ T cells This is supported by the fact that IL-15-...
  • 263
  • 427
  • 0
CD8 t cell mediated induction of interleukin 12p70 production by dendritic cells

CD8 t cell mediated induction of interleukin 12p70 production by dendritic cells

Ngày tải lên : 11/09/2015, 09:11
... the elimination of infected and tumor cells CD8 T cells start off as naïve T cells that circulate the body after development in the thymus CD8 T cells are activated by encounter with antigen, which ... Lambrecht, 2008) Stimulation of epithelial cells via PRRs results in the production of thymic stromal lymphopoietin (TSLP) that directly activates DCs to prime CD4 T cells to differentiate into Th2 cells ... instance CD28 stimulation by CD80 /86 that is essential for optimal T cell proliferation and activation Signal three represents factors that determine the character of the T cell response i.e Th1,...
  • 197
  • 186
  • 0
Báo cáo y học: "Differential clinical efficacy of anti-CD4 monoclonal antibodies in rat adjuvant arthritis is paralleled by differential influence on κ α NF-κB binding activity and TNF-α secretion of T cell" pot

Báo cáo y học: "Differential clinical efficacy of anti-CD4 monoclonal antibodies in rat adjuvant arthritis is paralleled by differential influence on κ α NF-κB binding activity and TNF-α secretion of T cell" pot

Ngày tải lên : 09/08/2014, 03:24
... differential contribution of the CD4+ and CD8+ T- cell subpopulation and suggests that interactions between CD4+ and CD8+ T cells [S9] are critical for T- cell activation and the effects of anti -CD4 ... results T- cell reactivity in vitro Total T cells and CD4+ T cells from spleens of individual rats (day 13 of AA) were stimulated in vitro with ConA The in vitro proliferation rates of total T cells ... possibility that CD8+ T cells would mask the inhibitory potency of the anti -CD4 mAbs on the proliferation of CD4+ T cells in a total T- cell population was excluded by using purified CD4+ T cells They...
  • 14
  • 431
  • 0
Báo cáo y học: " Antibody microarray analysis of cell surface antigens on CD4+ and CD8+ T cells from HIV+ individuals correlates with disease stages" ppt

Báo cáo y học: " Antibody microarray analysis of cell surface antigens on CD4+ and CD8+ T cells from HIV+ individuals correlates with disease stages" ppt

Ngày tải lên : 13/08/2014, 05:22
... the writing LB and JC analyzed data, did statistical evaluation, contributed to the technology and the writing JL and DED contributed to vital patient samples and immunological interpretation of ... findings, together with ours, support the hypothesis that the CD8+ T cells from LNTP may have stronger cytotoxic activity than those from other HIV+ individuals CD16 expression on CD8+ T cells in ... CD4+ T cells Composite dot scan patterns of antibody binding for CD4+ T cells Half of a duplicate array was shown with the alignment dots "A" at left, top and bottom Alignment dots are a mixture...
  • 13
  • 289
  • 0

Xem thêm