caveolin 1 in brain tumors

Tài liệu Báo cáo khoa học: Caveolin-1 influences P2X7 receptor expression and localization in mouse lung alveolar epithelial cells docx

Tài liệu Báo cáo khoa học: Caveolin-1 influences P2X7 receptor expression and localization in mouse lung alveolar epithelial cells docx

... 11 12 13 Cav -1 P2X7R Flotillin -1 PDI -Cop TfR T1 Fig (A) Solubility of Caveolin- 1, Flo -1 and P2X7 receptor in Triton X -10 0 E10 cells were lysed in a buffer containing 1% Triton X -10 0 to obtain ... Rassendren F (19 98) Membrane FEBS Journal 274 (2007) 30 21 3033 ª 2007 The Authors Journal compilation ª 2007 FEBS 30 31 Caveolin- 1 and P2X7 expresssion in lung cells 10 11 12 13 14 15 16 17 18 19 20 K ... determined Figure 5A shows a Caveolin- 1 staining pattern at the cell surface, confirming the known caveolar location of Caveolin- 1 In addition, intracellularly distinguishable punctate patterns of Caveolin- 1...

Ngày tải lên: 19/02/2014, 00:20

13 440 0
báo cáo hóa học: " Anandamide inhibits Theiler’s virus induced VCAM-1 in brain endothelial cells and reduces leukocyte transmigration in a model of blood brain barrier by activation of CB1 receptors" pdf

báo cáo hóa học: " Anandamide inhibits Theiler’s virus induced VCAM-1 in brain endothelial cells and reduces leukocyte transmigration in a model of blood brain barrier by activation of CB1 receptors" pdf

... Cnr1-/contralateral 12 , 013 ± 0,489 13 ,223 ± 0,788 15 ,909 2,327 15 909 ± 327 Ipsilateral 20,028 ± 1, 257## 21, 3 41 ± 0,958## 19 ,657 1, 120 19 657 ± 12 0# contralateral 16 ,956 ± 0, 913 17 ,15 1 ± 1, 007 16 ,320 ... approved the final manuscript Competing interests The authors declare that they have no competing interests Received: 11 May 2 011 Accepted: 18 August 2 011 Published: 18 August 2 011 References ... Mending the broken brain: neuroimmune interactions in neurogenesis J Neurochem 2 010 , 11 4 :12 77 -12 90 36 Pertwee RG: Emerging strategies for exploiting cannabinoid receptor agonists as medicines...

Ngày tải lên: 19/06/2014, 22:20

13 466 0
Báo cáo khoa học: "Increased phosphorylation of caveolin-1 in the spinal cord of irradiated rats" pdf

Báo cáo khoa học: "Increased phosphorylation of caveolin-1 in the spinal cord of irradiated rats" pdf

... antigen-presenting cells by means of caveolin- 1 Proc Natl Acad Sci USA 2004, 10 1, 14 186 -14 1 91 11 Okamoto T, Schlegel A, Scherer PE, Lisanti MP Caveolins, a family of scaffolding proteins for organizing ... IL -1 induces the phosphorylation of caveolin- 1 in HIT-T15 cells [12 ] Therefore, it is highly probable that IL -1 induces the phosphorylation of caveolin- 1 in the microglia, leading to the inflammatory ... the Western blot for p -caveolin- 1 (A), ED1 (B), fibronectin (C) and beta-actin The p -caveolin- 1, ED1, and fibronectin immunoreactivities were detected at low levels in the spinal cords of the normal...

Ngày tải lên: 07/08/2014, 20:23

5 205 0
báo cáo hóa học:" Caveolin-1 enhances resveratrol-mediated cytotoxicity and transport in a hepatocellular carcinoma model" docx

báo cáo hóa học:" Caveolin-1 enhances resveratrol-mediated cytotoxicity and transport in a hepatocellular carcinoma model" docx

... 10 0 Cell groups DMSO 50 1. 53 ± 1. 6 3.62 ± 1. 8 2 .19 ± 1. 8 3.08 ± 1. 3 1. 37 ± 1. 7 1. 44 ± 1. 1 HepG2 CAV1 CAVM1 CAVM2 CAVRNAi GFP 20 6.83 ± 1. 9 13 .2 ± 1. 0 9.62 ± 1. 1 11 .5 ± 1. 4 5.05 ± 1. 4 6.05 ± 1. 8 ... 1. 8 10 .93 ± 1. 5 17 . 91 ± 2.5* 13 .5 ± 1. 8 15 .3 ± 1. 6 9.78 ± 1. 1 11 .2 ± 2.0 31. 2 ± 2 .1 78.7 ± 1. 7* 23 .1 ± 0.9 50 .1 ± 1. 7* 24.8 ± 2.5 32.7 ± 1. 6 200 300 63.2 ± 0.8 93.6 ± 2.0* 74 .1 ± 1. 8* 83.4 ± 1. 5* ... 8.8 24.2 8.6 8.5 13 .1 10.5 18 .5 2.3 12 .4 17 .4 17 .7 20.5 9.6 10 .0 16 .0 11 .1 10.2 5.9 14 .1 32 .1 25.0 20.7 38 .1 16.7 *P < 0.05 vs control, [ x ± SD, SD = (0.8~3.7), n = 3] Page of 13 (page number...

Ngày tải lên: 18/06/2014, 15:20

13 714 0
Báo cáo khoa học: "Immunohistochemical study of caveolin-1 and -2 in the rat retina" pps

Báo cáo khoa học: "Immunohistochemical study of caveolin-1 and -2 in the rat retina" pps

... iL ,T otomakO ,Z gnaT ,EP rerehcS ,SK gnoS 41 422 -12 2 ,62 ,69 91 seR teV J naeroK aniter kcud eht no dica ciniak fo stceffE M miK ,T nihS 31 02 -11 ,5 61 ,5002 lonummiorueN J sitileymolahpecne enummiotua ... level eht dna ealoevac fo rebmun eht setalugernwod negortsE N renlluM ,LA ssiK ,A iruT 51 5 615 1-0 615 1 ,17 2 ,69 91 mehC loiB J snietorpocylg detaicossa-nihportsyd dna nihportsyd htiw setanoitcarf-oc ... star siweL fo sdroc lanips eht ni 3- dna ,2- ,1- niloevac fo noisserpxE Y otomustaM ,N amunaT ,M nhA ,C nooM ,KJ niJ ,H miK ,T nihS 21 5 31- 1 31 ,39 ,69 91 ASU icS dacA ltaN corP ylimaf eneg niloevac...

Ngày tải lên: 07/08/2014, 18:21

4 365 0
Báo cáo khoa học: "Gamma-ray irradiation stimulates the expression of caveolin-1 and GFAP in rat spinal cord: a study of immunoblot and immunohistochemistry" pot

Báo cáo khoa học: "Gamma-ray irradiation stimulates the expression of caveolin-1 and GFAP in rat spinal cord: a study of immunoblot and immunohistochemistry" pot

... tneicifed -1- niloevaC PM itnasiL ,GP knarF ,MT smailliW ,SG nassaH 711 1 -11 11 , 91 ,10 02 locnO nilC J 7059 lairT puorG ygolocnO 313 yparehT noitaidaR fo stluser :emrofitlum amotsalboilg rof noitaidar lainarc ... 1- niloevaC SR noremaC ,RJ kciF ,TS sutnaH ,KD tramS ,C uiL ,LP noremaC 28 81 -57 81 ,8 ,99 91 teneG loM muH smsinahcem elpitlum ,seneg elpitlum-seihportsyd ralucsum eldrig-bmil ehT MK ybhsuB 11 11- 6 011 ... ,KJ niJ ,H miK ,T nihS 61 51- 01 ,332 ,6002 tteL recnaC amoleym elpitlum ni tegrat cituepareht wen laitnetop a sa 1- niloevaC CK nosrednA ,K radoP 51 2245- 914 5 ,372 ,89 91 mehC loiB J enarbmem amsalp...

Ngày tải lên: 07/08/2014, 18:21

6 374 0
Báo cáo khoa học: " Experimental iodine-125 seed irradiation of intracerebral brain tumors in nude mice" ppt

Báo cáo khoa học: " Experimental iodine-125 seed irradiation of intracerebral brain tumors in nude mice" ppt

... implanted 12 5I brachytherapy seed (intermitted line) or a sham seed (uninterrupted line) Figure HE-stained sections HE-stained sections Hematoxylin-eosin stained sections of mouse brain (a) Section ... frontolateral brain (Figure 2) A suspension of × 10 5 cancer cells in μl PBS was injected slowly during minute The syringe was removed and the skin closed; the mouse recovered after injection of 0 .1 ml ... to 88% for meningioma [5] Brachytherapy with radioactive iodine -12 5 (12 5I) seeds, which is effective against brain tumors, is used mostly for re-irradiation of recurrent brain tumors [6-9] Although...

Ngày tải lên: 09/08/2014, 10:21

7 393 0
Báo cáo y học: "Caveolin-1 expression and stress-induced premature senescence in human intervertebral disc degeneration" docx

Báo cáo y học: "Caveolin-1 expression and stress-induced premature senescence in human intervertebral disc degeneration" docx

... of caveolin- 1 protein in human nucleus pulposus Caveolin- 1 protein expression was investigated in 28 IVD samples (for sample details, see Table 2) Immunohistochemical analysis for caveolin- 1 demonstrated ... studies involving IL -1, that there are factors in the degenerate disc that may induce caveolin- 1 expression and thus lead to the senescent phenotype described in IVD cells [16 -18 ] Caveolin- 1- rich ... the role of caveolin- 1 in these related areas 13 14 15 16 Competing interests The authors declare that they have no competing interests 17 Authors' contributions SKH participated in the design...

Ngày tải lên: 09/08/2014, 10:23

9 317 0
Báo cáo y học: "Caveolin-1 influences human influenza A virus (H1N1) multiplication in cell culture" docx

Báo cáo y học: "Caveolin-1 influences human influenza A virus (H1N1) multiplication in cell culture" docx

... ABF 213 15 (A/USSR/90 /19 77(H1N1) ABD60935 (A/USSR/92/77(H1N1) 6093 ( / SS /92/ ( ) AB38 716 (A/USSR/90 /19 77(H1N1) ABD95352 (A/USSR/90/77(H1N1) ABD60946 (A/Hong Kong /11 7/77(H1N1) ABO4 413 6 (A/Tientsin/78 /19 77(H1N1) ... • • • ACP 411 09 (A/California/04/2009(H1N1) ACP 419 29 (A/California/05/2009(H1N1) ACP 419 38 (A/California/06/2009(H1N1) ACP 419 46 (A/Texas/05/2009(H1N1) ACP 419 51 (A/C lif i /09/2009(H1N1) (A/California/09/2009(H1N1) ... Binding aa 114 135 (enterotoxic peptide) amphipatic helix at the C-terminus Binding and colocalization, independent binding sites at the N-terminus (aa2-22)and Cterminus (aa1 611 78) identified, influence...

Ngày tải lên: 12/08/2014, 04:20

10 236 0
Báo cáo y học: " Caveolin-1 and -2 in airway epithelium: expression and in situ association as detected by FRET-CLSM" pps

Báo cáo y học: " Caveolin-1 and -2 in airway epithelium: expression and in situ association as detected by FRET-CLSM" pps

... (bp) Position of amplified DNA (bp) cav -1 Z46 614 .1 123 25 14 7 cav -1 Z46 614 .1 1 21 165–285 cav-2 BC062059 .1 106 392–497 cav-2 BC062059 .1 127 17 6–302 β-MG NM_ 012 512 Forward: CAGCATGTCTGGGGGTAAAT Reverse: ... adenovirus infection J Clin Invest 19 97, 10 0 :11 44 -11 49 Webley WC, Norkin LC, Stuart ES: Caveolin- 2 associates with intracellular chlamydial inclusions independently of caveolin1 BMC Infect Dis 2004, ... linguistic correction of the manuscript 16 19 20 21 References 10 11 12 13 14 15 Razani B, Woodman SE, Lisanti MP: Caveolae: from cell biology to animal physiology Pharmacol Rev 2002, 54:4 31- 467...

Ngày tải lên: 12/08/2014, 16:20

13 293 0
Caveolin 1 and lipid rafts in modulation of autophagy

Caveolin 1 and lipid rafts in modulation of autophagy

... Chapter 1. 1 Introduction AUTOPHAGY 1. 1 .1 Overview of autophagy 1. 1.2 The process of autophagy 1. 1.3 Autophagy machinery 1. 1.4 Lysosome 10 1. 1.5 ... 12 1. 1.6 Biological functions of autophagy 15 1. 1.7 Implication of autophagy in human diseases 20 1. 2 LIPID RAFTS AND CAV -1 27 1. 2 .1 Lipid rafts 27 1. 2.2 Caveolin- 1 ... 33 1. 3 LIPID RAFTS AND CAV -1 IN AUTOPHAGY 35 1. 3 .1 Lipid rafts in autophagy 35 1. 3.2 Cav -1 in autophagy 38 1. 4 LIPID RAFTS AND CAV -1 IN CANCER 39 1. 4 .1 Lipid rafts in...

Ngày tải lên: 09/09/2015, 08:13

187 524 0
Distribution of betaine gaba transporter BGT 1 in excitotoxic brain injury and its role in osmoregulation in the brain

Distribution of betaine gaba transporter BGT 1 in excitotoxic brain injury and its role in osmoregulation in the brain

... SUMMARY……………………………………………………………………… 14 CHAPTER 1: INTRODUCTION……………………………………………… 18 Maintenance of osmolarity in living cells……………………………………… .19 1. 1 Maintenance of osmolarity in the kidney………………………………… 20 1. 2 Maintenance ... betaine in brain are increased following salt loading, suggesting a role of betaine in osmoregulation in the CNS (Lien et al., 19 90) It is noteworthy that cerebral edema was clinically reported in ... important role in maintaining myo-inositol intracellular concentration (Fisher et al., 2002) 25 Osmolyte transporters 3 .1 Betaine/GABA transporter BGT -1 3 .1. 1 Cloning of BGT -1 Betaine, as a protective...

Ngày tải lên: 16/09/2015, 15:55

196 215 0
Level set segmentation of brain tumors in magnetic resonance images

Level set segmentation of brain tumors in magnetic resonance images

... (T1-pre contrast, 256×256 12 , tumor-contained slices: 3th-9th), Second row: Tumor 3, (T1-post contrast, 256×256 11 , tumor-contained slices: 2th -11 th) 58 3 .12 Improved segmentation results obtained ... 10 1 List of Figures 4 .11 The final segmentation results using SVM-based approach The indexes of tumors from top to bottom are: 2, 3, 5, 6, 8, 11 , and 13 First five columns ... result in good classification using a small training set, and the result depends on the training set To address this problem, the SVM training is iteratively refined as the level set grows • Defining...

Ngày tải lên: 08/11/2015, 17:33

155 229 0
Structures for writing task 1 in IELTS

Structures for writing task 1 in IELTS

... For describing the lowest point The number of students hit a trough/plunged to a trough of 2000 For describing a fluctuation The number fluctuated between ... The number fluctuated between and The number fluctuated wildly around and Some words for describing “approximately” About/around/approximately/well over/roughly ...

Ngày tải lên: 04/10/2012, 09:39

2 3,4K 161
Báo cáo y học: " Patient Specification Quality Assurance for Glioblastoma Multiforme Brain Tumors Treated with Intensity Modulated Radiation Therapy"

Báo cáo y học: " Patient Specification Quality Assurance for Glioblastoma Multiforme Brain Tumors Treated with Intensity Modulated Radiation Therapy"

... of pixels passing gamma criterion for the 10 patient treatment plans Patient’s fields numbers Fraction Planned Dose, cGy 11 11 11 IMRT fields total of = 83 200.0 219 .2 219 .2 200.0 219 .2 200.0 200.0 ... References 10 11 12 13 14 Birbilis TA, Matis GK, Eleftheriadis SG, et al Spinal metastasis of glioblastoma multiforme: an uncommon suspect? Spine (Phila Pa 19 76) 2 010 ; 35: E264-9 Fine HA The ... breathing during radiation therapy treatment of NSCLC Int J Med Med Sci 2 011 ; 3: 1- 6 Al-Mohammed HI Investigation of breathing maneuvers using free breathing and video biofeedback techniques during...

Ngày tải lên: 25/10/2012, 10:51

6 461 0
Báo cáo y học: "Hb J- Meerut [α 120 (H3) Ala -Glu (α1)] In A Turkish Male"

Báo cáo y học: "Hb J- Meerut [α 120 (H3) Ala -Glu (α1)] In A Turkish Male"

... stable hemoglobins only [3] Position 12 0 is external and is not involved in heme binding or subunit contacts but is involved in the 1 1 contacts in Hb molecule [11 ,12 ] The amino acid substitution ... globin genes Hemoglobin 19 82; 6 (1) : 27-46 10 Molchanova TP, Pobedimskaya DD, Postnikov Y A simplified procedure for sequencing amplified DNA containing the α2- or α1globin gene Hemoglobin 19 94; 18 (3):2 51- 255 ... Hemoglobin 19 94; 18 (3):2 51- 255 11 Sack JS, Andrews LC, Magnus KA, Hanson JC, Rubin J, Love WE Location of amino acid residues in human deoxy hemoglobin Hemoglobin 19 78; 2(2): 15 3 -16 9 12 Perutz MF, Lehmann...

Ngày tải lên: 02/11/2012, 10:09

2 503 0
Báo cáo y học: "PKC and PKA Phosphorylation Affect the Subcellular Localization of Claudin-1 in Melanoma Cells"

Báo cáo y học: "PKC and PKA Phosphorylation Affect the Subcellular Localization of Claudin-1 in Melanoma Cells"

... A589G_G590C T100G_C102A T100G_C102A T205G_C206A 18 8 -19 0 18 8 -19 0 18 8 -19 1 18 8 -19 1 RKT RKT RKTT RKTT PKA PKC PKC PKA A568G_C569A_A570C A568G_C569A_A570C A571G_C572A A571G_C572A 18 9 -19 2 KTTS [R/K]X[pS/pT] ... Kallioniemi O.P., Meltzer P., Morin P.J., and Weeraratna A.T Claudin -1 overexpression in melanoma is http://www.medsci.org Int J Med Sci 2009, 6 10 11 12 13 14 15 16 17 18 regulated by PKC and contributes ... and Furukawa Y Involvement of claudin -1 in the beta-catenin/Tcf 10 1 signaling pathway and its frequent upregulation in human colorectal cancers Oncol Res 20 01; 12 (11 -12 ): 469-476 19 Dissanayake...

Ngày tải lên: 03/11/2012, 11:17

9 592 0
Tài liệu What You Need To Know About - Brain Tumors ppt

Tài liệu What You Need To Know About - Brain Tumors ppt

... the brain and spinal cord Diffuse intrinsic pontine glioma usually occurs in children It forms in the brain stem Ependymoma (eh-PEN-dih-MOH-muh): A type of brain tumor that begins in cells lining ... tumors in most other parts of the body, benign brain tumors are sometimes life threatening —Benign brain tumors may become malignant • Malignant brain tumors (also called brain cancer) contain ... Types of Primary Brain Tumors There are many types of primary brain tumors Primary brain tumors are named according to the type of cells or the part of the brain in which they begin For example,...

Ngày tải lên: 14/02/2014, 21:20

51 444 0
Tài liệu Evidence-based Series 15-1 IN REVIEW : Screening for Skin Cancer doc

Tài liệu Evidence-based Series 15-1 IN REVIEW : Screening for Skin Cancer doc

... including total-body skin examination and counselling to perform skin self-examination? What characteristics should clinicians assess in order to determine risk for melanoma, basal cell carcinoma, ... awareness in outdoor workers in Israel Cancer Causes Control 2000 ;11 (6): 513 - 21 Berwick M, Begg CB, Fine JA, Roush GC, Barnhill RL Screening for cutaneous melanoma by skin self-examination J Natl ... by skin self-examination J Natl Cancer Inst 19 96;88 (1) :17 -23 PRACTICE GUIDELINE – page EBS 15 -1 IN REVIEW Funding The PEBC is supported by the Ontario Ministry of Health and Long-Term Care through...

Ngày tải lên: 15/02/2014, 05:20

5 379 0
Tài liệu Báo cáo khoa học: Role for nectin-1 in herpes simplex virus 1 entry and spread in human retinal pigment epithelial cells docx

Tài liệu Báo cáo khoa học: Role for nectin-1 in herpes simplex virus 1 entry and spread in human retinal pigment epithelial cells docx

... RPE cells FITC stained CHO-HVEM RPE D Events B 11 4 A C 10 1 10 2 11 9 10 0 10 3 10 4 FITC stained CHO-nectin -1 Events RPE 10 0 10 1 10 2 FITC 10 3 10 4 Fig Expression of HSV -1 gD receptors in RPE cells (A) ... 11 6, 12 73 12 81 Spillmann D (20 01) Heparan sulfate: anchor for viral intruders? Biochimie 83, 811 – 817 WuDunn D & Spear PG (19 89) Initial interaction of herpes simplex virus with cells is binding ... HSV -1 entry into RPE cells V Tiwari et al Fig Role of nectin -1 during HSV -1 entry into RPE cells (A) Antibody against nectin -1 significantly inhibits HSV -1 entry into cultured RPE cells Cells (indicated)...

Ngày tải lên: 18/02/2014, 14:20

14 672 0
w