categorized list of gene expression level changed between grr1δ and wild type yeast see page 180 for details

Báo cáo y học: "Genome-wide patterns of carbon and nitrogen regulation of gene expression validate the combined carbon and nitrogen (CN)-signaling hypothesis in plants" pptx

Ngày tải lên : 14/08/2014, 14:21

... of genes in the pathway being analyzed and in the child list, and p was the number of genes in the pathway being analyzed and in the parent list divided by the number of genes in the parent list ... CN-element gene for an alignment Despite this lack of similarity, we tested for the presence of CN1 and CN2 in the promoter of this gene; three copies of CN1 (p-value = 0.052) and one copy of CN2 ... complete understanding of interactions between carbon and nitrogen signaling Materials and methods Plant growth and treatment for analysis Arabidopsis thaliana seeds of the Columbia ecotype were surface-sterilized...

15
314
0

Báo cáo y học: "Systematic analysis of gene expression in human brains before and after death" docx

Ngày tải lên : 14/08/2014, 16:20

... correlations between gene expression levels and postmortem delay in the 40 brain autopsy samples for 1,752 probe sets that differ in expression between autopsy and resection samples and for 1,000 ... suitable for gene expression studies Without any prolonged agonal conditions, however, death itself may alter gene expression patterns in postmortem human brains Study of expression levels of 14 genes ... number of up- and down-regulated genes in the autopsy samples Bold font indicates Gene Ontology (GO) groups with significant excess of up- or down-regulated genes (see Materials and methods) Expression...

9
299
0

Báo cáo y học: "A dynamic model of gene expression in monocytes reveals differences in immediate/early response genes between adult and neonatal cells" potx

Ngày tải lên : 11/08/2014, 08:21

... cellular adhesion, and collectively highlight the importance of examining gene expression profiles (or related protein expression levels) over time The limits of gene expression profiling as a technique, ... of kinetics of expression Expression level (in relative intensity units) is shown of the y-axis and time on the x-axis At the 45 time point, significant differences in expression level were seen ... UniGene and RefSeq databases The RefSeq database is an effort by the NCBI to create a true reference database of genomic information for all genes of known function All 11,000 human genes of...

19
444
0

Báo cáo y học: "Developing a systems-level understanding of gene expression" doc

Ngày tải lên : 14/08/2014, 07:21

... patterns for 80% of cis-regulatory modules Spatio-temporal patterns of gene expression in multi-cellular organisms In multicellular organisms, spatial aspects of gene expression are often studied ... that new and improved technologies (such as sequencing, microfluidics, highdensity tiling arrays and microscopy) are fueling the rapid expansion of a systems -level understanding of gene expression ... importance of noncoding RNAs and their role in regulating gene expression, as well as the extent of post-transcriptional regulation Epigenetic modifications, the dynamic nature of chromatin and its...

3
213
0

Analysis of gene expression

Ngày tải lên : 25/10/2013, 22:20

... Labeling of a PCR-amplified probe with DIG as part of in situ RT-PCR indirect detection of gene expression expression standard RT-PCR was performed showing specific amplification of the TNF gene For ... the manufacturer of the imaging equipment These programs allow integration of the intensity of the band and provide a numerical value for the level of signal The use of a standard, such as actin, ... boost the measurable levels of ‘transcript’ in the form of cDNA This process requires between 50 and 500 ng of total RNA, which is significantly less than is required for standard Northern blotting...

24
318
0

Tài liệu Báo cáo khoa học: The splicing factor ASF/SF2 is associated with TIA-1-related/ TIA-1-containing ribonucleoproteic complexes and contributes to post-transcriptional repression of gene expression doc

Ngày tải lên : 16/02/2014, 15:20

... control of gene expression As each step of the RNA metabolism is tightly regulated, the regulation of mRNA export, stability and translation rate is essential for the control of the expression of ... Subcellular distribution of ASF ⁄ SF2 wild- type and mutated forms upon inhibition of transcription Transfected COS cells were treated for h with cycloheximide (20 lgÆmL)1) and actinomycin D (5 lgÆmL)1) ... recovered and mixed with an equal volume of SDS buffer (0.2 m Tris, pH 7.5, 0.3 m NaCl, 25 mm EDTA, 2% SDS) and twice extracted with phenol ⁄ chloroform, once extracted with chloroform, and precipitated...

19
666
0

Tài liệu Báo cáo khoa học: Time-dependent regulation analysis dissects shifts between metabolic and gene-expression regulation during nitrogen starvation in baker’s yeast doc

Ngày tải lên : 18/02/2014, 06:20

... transcript level of PGI1 did not change signiﬁcantly The transcript levels of the TDH genes, which code for GAPDH, were changed signiﬁcantly (Student’s t-test, P < 0.05) TDH1 was increased, and TDH2 and ... regulation took place at the mRNA level, we measured the transcript levels of nearly all glycolytic and fermentative genes using qPCR (Fig 6) First, the Vmax levels of PGI and GAPDH remained constant ... behaviour of PGI during glucoseexcess conditions in the presence of nitrogen is an example of this form of regulation A summary of all regulation is given in Table This shows visually that of 10...

16
654
0

Impact of Gene Expression Profiling Tests on Breast Cancer Outcomes potx

Ngày tải lên : 06/03/2014, 01:20

... endocrine therapy, and anti-HER-2 therapy, alone or in combination Gene Expression Profiling Gene expression profiling (see Glossary, Appendix B) is an emerging technology for identifying genes whose ... single or multiple gene predictors not involved ‡ in one of the gene expression profile tests of interest: 150 Article does not involve one of the three gene expression tests of interest: 659 No ... measurements for the two genes (HOXB13 and IL17RB), and one, Ma 2004,64 study compared ER status by RT-PCR and IHC (see Tables 9, 10, and 11) No comparisons were made between expression measurements of...

230
486
0

Báo cáo khoa học: Modiﬁed PCR methods for 3¢ end ampliﬁcation from serial analysis of gene expression (SAGE) tags doc

Ngày tải lên : 07/03/2014, 00:20

... analysis of gene expression: rapid RT-PCR analysis of unknown SAGE tags Nucleic Acids Res 27, e17 34 Chen JJ, Rowley JD & Wang SM (2000) Generation of longer cDNA fragments from serial analysis of gene ... II: 22 lL of H2O, 15 lL of m NaClO4, and 38 lL of 2-propanol Precipitation mixture III: 64 lL of a 100% ethanol ⁄ m NaAc mixture (25 : 1), lL of glycogen (20 mgÆmL)1; Roche), and 10 lL of H2O Master ... (2005) Analysis of long-lived C elegans daf-2 mutants using serial analysis of gene expression Genome Res 15, 603–615 10 Ryu EJ, Angelastro JM & Greene LA (2005) Analysis of gene expression changes...

12
544
0

Báo cáo khoa học: Semi-nested PCR analysis of unknown tags on serial analysis of gene expression potx

Ngày tải lên : 07/03/2014, 04:20

... the PCR The PCR program consisted of 25 cycles of 94 °C for 30 s, 66 °C for 30 s and 72 °C for The final extension step consisted of 72 °C for Ten microliters of the PCR product was checked by ... application of the TSAT-PCR method, we obtained the PCR products (Fig 4) of all tags tested using the standard PCR condition (first PCR, 94 °C for 30 s, 55 °C for 30 s and 72 °C for 30 s for 15 cycles; ... analysis of gene expression (SAGE) characterization of orphan SAGE tags from human embryonic stem cells identifies the presence of novel transcripts and antisense transcription of key pluripotency genes...

7
529
0

báo cáo hóa học:" Site-specific analysis of gene expression in early osteoarthritis using the Pond-Nuki model in dogs" pot

Ngày tải lên : 20/06/2014, 00:20

... sets used for Real-Time PCR analysis Gene Orientation Primer Sequence Amplicon Size Melt Temp GAPDH FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC GTGACTTCAACAGTGACACC ... development of OA and for studies aimed at developing and evaluating diagnostic, preventative, and therapeutic strategies for OA Page of 12 (page number not for citation purposes) Journal of Orthopaedic ... content of the tissues between ACL-X and control joints for any of the regions tested Error bars indicate standard error of the mean Values are μg of HP/mg of tissue wet weight Differential gene expression...

12
521
0

Báo cáo hóa học: " Research Article Clustering of Gene Expression Data Based on Shape Similarity" potx

Ngày tải lên : 22/06/2014, 00:20

... μxg represents the mean of xg 2.3 Extraction of Shape Information and Time Scaling To extract shape information of time-varying gene expression, the derivative of the expression trajectory is ... misclassiﬁcation rates for the KM/SilT, KM/SilR, and V/SilT were generally on the order of 10–20%, V/SilR was very stable, generally between 3-4% 8 EURASIP Journal on Bioinformatics and Systems Biology ... approach for clustering gene expression data with error information,” BMC Bioinformatics, vol 7, article 17, pp 1–15, 2006 [13] A Ben-Hur, A Elisseeﬀ, and I Guyon, “A stability based method for discovering...

12
335
0

Báo cáo sinh học: "Promoter architecture and the evolvability of gene expression" pdf

Ngày tải lên : 06/08/2014, 19:21

... evolvability of gene expression Science 2007, 317:118-121 38 Rando OJ, Verstrepen KJ: Timescales of genetic and epigenetic inheritance Cell 2007, 128:655-668 39 Raser JM, O’Shea EK: Noise in gene expression: ... As noted above, expression divergence (the extent to which expression of a gene evolves) correlates with expression responsiveness (the extent to which expression of a gene is changed in response ... remove hybridization bias for interspecies comparison of global gene expression profiles uncovers an association between mRNA sequence divergence and differential gene expression in Xenopus Nucleic...

6
346
0

Báo cáo y học: "Microarray analysis of gene expression in lupus" ppt

Ngày tải lên : 09/08/2014, 01:23

... with effects of both IFN-α/β and IFN-γ on gene expression In addition to this set of IFN-induced genes, gene expression profiles indicating ischemia and myofiber degeneration and regeneration were ... samples using the expression of a subset of genes; estimates accuracy of the gene panel on a prospective set CART: Salford Systems, http://www.salford-systems.com/ MART: Stanford University, http://www-stat.stanford.edu/~jhf/R-MART.html ... GeneChips Genes showing at least a twofold difference in comparisons of JDM samples with each of two control samples were used to develop a list of differentially expressed genes Ninety-one genes...

9
473
0

Báo cáo y học: "Perspectives and limitations of gene expression profiling in rheumatology: new molecular strategies" doc

Ngày tải lên : 09/08/2014, 01:23

... collating of information and development of molecular network models will be essential and will provide the basis for functional interpretation Current status of gene expression profiling in ... and bone resorption, also demand the identification of targets to directly inhibit destruction and/ or to induce regeneration and repair A deeper knowledge of pathophysiological networks and gene ... experiments Chemotactic importance for monocyte migration was demonstrated for RANTES and MCP-2, and for T-cell migration only for RANTES The expression of GCP-2 and MCP-2, which have not yet been...

7
382
0

Báo cáo y học: "The protective effect of licofelone on experimental osteoarthritis is correlated with the downregulation of gene expression and protein synthesis of several major cartilage catabolic factors: MMP-13, cathepsin K and aggrecanase" docx

Ngày tải lên : 09/08/2014, 06:23

... correlation exists between the mRNA and protein levels At the two dosages tested, the R1094 ADAMTS-4 and ADAMTS-5 gene expression and protein synthesis The level of gene expression of ADAMTS-5 in ... Treatment with licofelone had little effect on the level of its gene expression or on the level of protein In contrast, the level of expression of mRNA for ADAMTS-4 was found to be significantly increased ... in situ effect of licofelone on the gene expression and protein synthesis of the major collagenolytic enzymes (MMP-13 and cathepsin K) and aggrecandegrading proteases (ADAMTS-4 and ADAMTS-5) in...

12
1.2K
0

Global orchestration of gene expression by the biological clock of cyanobacteria Carl Hirschie Johnson pot

Ngày tải lên : 09/08/2014, 20:20

... modulation of the transcription rates of all genes, accounting for the global regulation of gene expression [22] Gene- specific cis-regulatory elements that mediate rhythmic gene expression might therefore ... for the circadian system of cyanobacteria KaiA, KaiB, and KaiC are synthesized from the kaiABC cluster using two promoters: kaiAp (driving expression of KaiA) and kaiBCp (driving expression of ... http://genomebiology.com/2004/5/4/217 Clock-dominated expression (a) (e) Wild- type (b) KaiC overexpression Luminescence Time in constant light (c) Clock-modulated expression (f) Wild- type KaiC overexpression (d) Time in constant...

4
247
0

Curcumin modulates dopaminergic receptor, CREB and phospholipase c gene expression in the cerebral cortex and cerebellum of streptozotocin induced diabetic rats potx

Ngày tải lên : 10/08/2014, 05:21

... mixture of 20 μl contained 25 ng of total RNA-derived cDNAs, 200 nM each of the forward primer, reverse primer and TaqMan probe for assay on demand and endogenous control β-actin and 12.5 μl of Taqman ... and it reversed to near control value in insulin and curcumin treated diabetic rats (Figure and 4) Page of 11 Real Time-PCR Analysis of CREB in the cerebral cortex and cerebellum of control and ... tissue and the equilibrium dissociation constant is the measure of the affinity of the receptors for the radioligand The Kd is inversely related to receptor affinity Analysis of gene expression...

11
413
0

báo cáo khoa học: " Analysis of gene expression in response to water deficit of chickpea (Cicer arietinum L.) varieties differing in drought tolerance" pps

Ngày tải lên : 12/08/2014, 03:21

... difference between these two clusters Average expression intensity of the cluster genes was much higher than that of the cluster genes and there was uniformity in the expression of the cluster genes ... chickpea genes were distributed into 11 clusters based on their expression profiles (A), the SOTA clustering tree (B), expression profiles of SOTA clusters The expression profile of each individual gene ... characterization of genes in each cluster Detail information of genes within each cluster is elaborated in Additional File and Monitoring expression profiles of selected high expressing genes More...

14
370
0

Báo cáo y học: " 3′-coterminal subgenomic RNAs and putative cis-acting elements of Grapevine leafroll-associated virus 3 reveals ‘unique’ features of gene expression strategy in the genus Ampelovirus" potx

Ngày tải lên : 12/08/2014, 04:20

... profile for the amplification of DNA included denaturation at 94°C for followed by 35 cycles of denaturation at 94°C for 10 sec, annealing at 56°C for 30 sec and extension at 72°C for 60 sec and ... 2010, 7 :180 http://www.virologyj.com/content/7/1 /180 Page of 14 Figure RACE analysis of 5′NTR of GLRaV-3 (a) The schematic diagram showing the locations of primers used and expected size of amplicons ... of the NTRs of GLRaV-3 (a) 5′NTR of Washington (WA) and South Africa (SA) isolates and (b) 3′NTR of WA isolate (complement) nt 3′NTR of Washington, New York, Chile and South Africa isolates of...

14
353
0