case studiesnote cases are used with permission of the kellogg school of management the copyright on individual c
230FIGURE EX26Open-low–break setup. (RealTick graphics are used with permission of Townsend docx
Ngày tải lên :
22/06/2014, 18:20
... under $42, which is what I wanted for the remaining quarter of my position The tape-reading principle of faster selling is shown on the chart at the circle the one with the vertical price bar that ... FIGURE EX28 Short of the range resistance (RealTick graphics are used with permission of Townsend Analytics, Ltd.) PART THREE Practical Examples 235 order to assess the action within the base to determine ... Drop-base–implosion (DBI) setup (RealTick graphics are used with permission of Townsend Analytics, Ltd.) 242 PART THREE Practical Examples Once the trade setup was triggered on the break of support, with...
- 26
- 217
- 0
SPECIAL REPORT: National Survey of Children’s Health Finds Intact Family and Religious Participation Are Associated with Fewer Developmental Problems in School-Age Children pdf
Ngày tải lên :
28/03/2014, 09:20
... And 53 percent of the former group – versus 21 percent of the latter – had their parents contacted by the school because of conduct or achievement problems the youth was having at school These differences ... neither factor in their favor Grade repetition, school contacts, and parental concern about child achievement are more strongly linked to a lack of an intact two-parent family than to a lack of ... parents are least likely to have their parents contacted by school teachers or administrators about school- related problems Percent of Children Whose Parents Were Contacted by School about Children's...
- 36
- 343
- 0
Báo cáo y học: " The anti-inflammatory effects of the tellurium redox modulating compound, AS101, are associated with regulation of NFB signaling pathway and nitric oxide induction in macrophages" doc
Ngày tải lên :
11/08/2014, 08:22
... subjected to PCR amplification using NFkB consensus site specific (forward:CAAGCCAGGGT ATGTGGTTT; reverse:GCAGCAGCCATCAGGTA TTT) and non-specific (forward: TTGGCACCATC TAACCTCAC, reverse:TGGTGTATCCTCATGCAA ... region vs LPS treatment alone (Fig 4) Accumulated evidence suggests that much of the biological activity of organotellurium compounds is directly related to their specific chemical interactions with ... http://www.journal-inflammation.com/content/7/1/3 GH carried out the IL-6 ELISA, participated in the statistical analysis and in the coordination of the study MA participated in the design of the study, its coordination...
- 8
- 581
- 0
Báo cáo sinh học: "Long telomeres in the polytene chromosomes of Drosophila melanogaster are associated with amplification of subtelomeric repeat sequences" doc
Ngày tải lên :
14/08/2014, 20:20
... stock designated T-32, which is characterized by the presence of additional chromatin in the telomeres of the chromosome arms X and 2L T-32 originates from flies collected in N’Djamena (Chad, Central ... additional chromatin of the long telomeres intensively hybridizes with labeled Dm665 sequences The short telomeres show a much weaker hybridization (or none at all) with the probe sequences We conclude ... all the sublines the long X and 2L telomeres carrying additional chromatin can be seen to hybridize effectively with the telomere-associated probes The appearance of additional chromatin in the...
- 10
- 298
- 0
A Comparative Analysis of Management Accounting Systems on Lean Implementation
Ngày tải lên :
10/12/2016, 17:12
... decision making [62] Much of the research in the area lean/JIT has focused on the impact the techniques on operation performance levels In these studies, the control variables used most often are ... implemented on financial structure of the production environment Their model assumes many non-traceable costs as indirect cost and used the proportion of these cost while calculating the product cost ... consume activities These activities trigger the consumption of resources that are recorded as costs in the accounts Cost management is not confined to cost reduction, but covers enterprise wide activities...
- 114
- 386
- 0
Reproductive Senescence in a Long-Lived Seabird: Rates of Decline in Late-Life Performance Are Associated with Varying Costs of Early Reproduction pot
Ngày tải lên :
28/03/2014, 16:20
... senescence in the ¨ collared flycatcher Ficedula albicollis by reproductive costs Nature 347:279–281 Gustafsson, L., and W J Sutherland 1988 The costs of reproduction in the collared flycatcher Ficedula ... were the worst breeding years on record since 1980), then these residual effects of early conditions will continue to impact the dynamics of the colony over the next 20 years or so as current cohorts ... Studying climate effects on ecology through the use of climate indices: the North Atlantic Oscillation, El Nino Southern Oscillation and beyond Proceedings ˜ of the Royal Society B: Biological Sciences...
- 13
- 362
- 0
báo cáo sinh học:" Are doctors and nurses associated with coverage of essential health services in developing countries? A cross-sectional study" ppt
Ngày tải lên :
18/06/2014, 17:20
... disease-specific mechanisms and are often co-funded by the international community For treatment of ARI, the lack of association with GDP may reflect the importance of other organizational factors, including ... services were: antenatal care, use of skilled birth attendants, caesarean section, measles immunization, TB case diagnosis and care for acute respiratory infection (ARI) Methods The predilection of ... Short Course (DOTS) All the dependant variables were expressed as the proportion utilizing the service of the population in need, which varied by service In the case of caesarean section, the variable...
- 9
- 472
- 0
báo cáo hóa học: " Indoors illumination and seasonal changes in mood and behavior are associated with the health-related quality of life" pdf
Ngày tải lên :
18/06/2014, 19:20
... we cannot present any causal deduction concerning the associations we found Another limitation was the use of self-reports of the seasonal changes in mood and behavior, and of the illumination ... circadian clock genes and in their regulation through the feedback the principal circadian clock receives may make a difference [27] Our limitation was the cross-sectional study design, and therefore ... lighting standards are based on specifications concerning the visual requirements If the non-visual effects of light exposure to the eyes which contribute to the seasonal changes in mood and...
- 8
- 469
- 0
Báo cáo sinh học: " Typing of human rotaviruses: Nucleotide mismatches between the VP7 gene and primer are associated with genotyping failure" pdf
Ngày tải lên :
19/06/2014, 08:20
... (Qiagen/Westburg, Leusden, The Netherlands) was used according to the manufacturer's instructions for the extraction of rotavirus RNA from the stool samples Because of the natural variation in the rotaviral ... reaction was carried out with an initial reverse transcription step at 45 C for 30 min, followed by 35 cycles of amplification (30 sec at 94 C, 30 sec at 50 C, at 72 C) , and a final extension of ... 5’ CAAGTACTCAAATCAGTGATGG Target sequence 3’ CAAGTACTCAAATCAATGATGG Gouvea primer, aBT1 Figure Nucleotide mismatches in the primers Nucleotide mismatches in the primers The target sequence is the...
- 5
- 389
- 0
báo cáo hóa học: " Low ficolin-3 levels in early follow-up serum samples are associated with the severity and unfavorable outcome of acute ischemic stroke" pptx
Ngày tải lên :
19/06/2014, 22:20
... non-parametric Spearman’s correlation coefficients The categorical variables were compared with the χ2 test for trend The association between the serum concentration of selected proteins and the ... percentiles in parentheses unless stated otherwise Results The concentrations of the proteins of the lectin pathway and CRP in the sera of patients with ischemic stroke, as compared to healthy controls ... protein in the sera of patients with acute ischemic stroke Concentrations at the time of hospital admission and on day 3, as compared to healthy controls (HC) and patient controls (PC, patients with...
- 27
- 434
- 0
Báo cáo hóa học: " Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure of a specific lineage from G1 rotavirus strains" potx
Ngày tải lên :
20/06/2014, 01:20
... http://www.virologyj.com/content/3/1/35 10 11 12 13 This analysis shows that the failure on the detection of the G1 strains could be due to the diversification of rotavirus strains in phylogenetic lineages, ... showed the four specific mismatches at the 5' end of the 9T1-1 primer This was associated with the failure of genotyping of G1 strains from Bangladesh Two of them showed more than four nucleotide ... this complex epidemiology [15] However, in recent years it was reported that the accumulation of point mutations in VP4 and VP7 genes was the main cause of the failure of the G or P-typing of rotavirus...
- 4
- 329
- 0
báo cáo hóa học:" Typing of human rotaviruses: Nucleotide mismatches between the VP7 gene and primer are associated with genotyping failure" pptx
Ngày tải lên :
20/06/2014, 04:20
... (Qiagen/Westburg, Leusden, The Netherlands) was used according to the manufacturer's instructions for the extraction of rotavirus RNA from the stool samples Because of the natural variation in the rotaviral ... reaction was carried out with an initial reverse transcription step at 45 C for 30 min, followed by 35 cycles of amplification (30 sec at 94 C, 30 sec at 50 C, at 72 C) , and a final extension of ... 5’ CAAGTACTCAAATCAGTGATGG Target sequence 3’ CAAGTACTCAAATCAATGATGG Gouvea primer, aBT1 Figure Nucleotide mismatches in the primers Nucleotide mismatches in the primers The target sequence is the...
- 5
- 355
- 0
báo cáo hóa học:" Decreased levels of serum glutathione peroxidase 3 are associated with papillary serous ovarian cancer and disease progression" pot
Ngày tải lên :
20/06/2014, 08:20
... M, Choi KH: Evaluation of the accuracy of serum human epididymis protein in combination with CA125 for detecting ovarian cancer: a prospective case- control study in a Korean population Clin Chem ... number of recent studies in clear cell ovarian cancer tissues conducted by others have identified a higher expression of GPX3 when compared to control cells and in other epithelial ovarian cancer ... expression is higher in clear cell epithelial ovarian carcinoma tissue [24-26] Clear cell cancers account for approximately 5% of all ovarian cancers The most common histology of ovarian cancer is...
- 8
- 439
- 0
Báo cáo y học: "Serum levels of autoantibodies against monomeric C-reactive protein are correlated with disease activity in systemic lupus erythematosus" potx
Ngày tải lên :
09/08/2014, 01:23
... glomerulonephritis, often contrasting with levels of other acutephase reactants, might in fact be due to the consumption of CRP by ICs [35] With this in mind we find the high frequency (4 of 4) of anti-CRP in ... when the tissue microenvironment becomes acidic owing to inflammation, CRP is dissociated to mCRP, which further enhances the binding of ICs to FcγRs [19] In addition, by binding C1 q, CRP has complement-activating ... component [4,18] Furthermore, CRP binds ICs [19] and facilitates the clearance of soluble or particulate ‘debris’ by means of phagocyte Fcγ receptors (FcγRs) [3,20–22] Some of these effects can...
- 8
- 349
- 0
báo cáo khoa học: "Primary malignant mixed müllerian tumor of the peritoneum a case report with review of the literature" doc
Ngày tải lên :
09/08/2014, 01:24
... appearance of the tumor, the most important of which are the “collision”, “conversion” and the “combination” theory [1] Sternberg et al [20] was the first to suggest the conversion, stating that sarcomatous ... that time onward, a number of cases with metachronous or synchronous gynaecologic carcinoma have been reported [11,14,16] Masuda et al [21] further supported the conversion theory with their study ... develop from carcinoma They described a case of metastatic heterologous type carcinosarcoma of the omentum with primary endometrial origin There was no evidence of sarcoma component in the primary...
- 4
- 461
- 0
báo cáo khoa học: "Primary sarcoma of the pancreas, a rare histopathological entity. A case report with review of literature" pps
Ngày tải lên :
09/08/2014, 02:20
... ulceration on ERCP (the arrow points at a × cm ulceration in the duodenum on ERCP) On laparotomy a large tumor of the pancreatic caput enclosing the superior mesenteric and hepatic arteries with ... pancreatic sarcoma after review 5000 cases of pancreatic cancer [1] Amongst pancreatic sarcomas leiomyosarcomas tend to occur relatively frequent [2] Epitheloid sarcomas also known as carcinosarcomas ... unspecific to sarcomas Gray and many others consider a painless jaundice as a sign of an advanced lesion [5] This was true for the case presented Conclusion Primary sarcomas of the pancreas are...
- 4
- 694
- 0
Báo cáo khoa học: "Gallbladder perforation associated with carcinoma of the duodenal papilla: a case report" pdf
Ngày tải lên :
09/08/2014, 03:21
... and malignancy are major risk factors for GBP [1] Most cases of GBP follow an exacerbation of acute cholecystitis with cholelithiasis, and GBP without gallstones is rare Such cases are mainly ... 10% of patients with a pT1 carcinoma of the papilla Therefore, Kausch-Whipple procedure or PPPD with lymph node dissection is the first choice of treatment even in patients with localized cancer, ... although local resection might be beneficial in patients with a poor general condition [12,13] Conclusion Although extremely rare, carcinoma of the duodenal papilla can be associated with GBP and...
- 3
- 312
- 0
Báo cáo khoa học: "Malignant gastrointestinal stromal tumor presenting with hemoperitoneum in puerperium: report of a case with review of the literature" ppt
Ngày tải lên :
09/08/2014, 03:22
... Part of the tumor was covered by the instinal musosa The cut surface demonstrated whitish-gray solid parenchyma, with two cystic areas of degeneration with hemorrhagic fluid; the largest cyst ... http://www.wjso.com/content/8/1/95 or as a tool for the assessment of cancer Pelvic CT scanning is not indicated during pregnancy Surgery should be immediate considered in cases of acute symptoms or suspicious ... bleeding of the mass A diagnosis of GIST during pregnancy is very uncommon [6-8] Those few cases reported were symptomatic and found in the second half of the pregnancy, leading to an emergency cesarean...
- 7
- 457
- 0
Báo cáo y học: "Angiogenic and angiostatic factors in systemic sclerosis: increased levels of vascular endothelial growth factor are a feature of the earliest disease stages and are associated with the absence of fingertip ulcers" doc
Ngày tải lên :
09/08/2014, 06:22
... of morphological changes can be detected (e.g megacapillaries, bushy capillaries) The modification of the angiogenic process is thus contributing to the chronically reduced oxygen supply of the ... drawbacks of a therapy with a single angiogenic growth factor have to be carefully considered The present study indicates further that the biologic effects of VEGF are counteracted by a concerted ... Subcommittee for scleroderma criteria of the American Rheumatism Association Diagnostic and Therapeutic Criteria Committee Preliminary criteria for the classification of systemic sclerosis (scleroderma)...
- 10
- 432
- 0
Báo cáo khoa học: "Advantage of vacuum assisted closure on healing of wound associated with omentoplasty after abdominoperineal excision: a case report" pdf
Ngày tải lên :
09/08/2014, 07:22
... exenteration associated with high risk of infection Consent Written informed consent was obtained from the patients for publication of this case report and accompanying images A copy of the written consent ... panproctocolectomy combined with perineal resection was indicated for the development of malignancy and synchronous multiple area of dysplasia in the background of chronic severe colitis The rectum was ... measured 20 cm × 17 cm) and set at 125 mmHg suction (figure 2) As in the case described above, suction was chosen in function of perineal pain The pressure of suction was applied in the absence of perineal...
- 5
- 310
- 1