case 71 a low normal preoperative blood glucose level
Báo cáo y học: " Differential temporal profile of lowered blood glucose levels (3.5 to 6.5 mmol/l versus 5 to 8 mmol/l) in patients with severe traumatic brain injury" docx
Ngày tải lên :
13/08/2014, 11:22
... Kato T, Nakayama N, Yasokawa Y, Okumura A, Shinoda J, Iwama T: Statistical image analysis of cerebral glucose metabolism in patients with cognitive impairment following diffuse traumatic brain ... predefined cluster as a percentage of the absolute number of all values of a certain parameter, for instance arterial blood glucose Blood glucose variability was assessed by calculating the arithmetic ... week, any additional insults, such as hypogycaemia, hyperglycemia and changing blood glucose values, should be avoided to prevent secondary brain damage Apart from hypoglycaemia-induced damage,...
- 13
- 393
- 0
Ruta 6 selectively induces cell death in brain cancer cells but proliferation in normal peripheral blood lymphocytes: A novel treatment for human brain cancer doc
Ngày tải lên :
22/03/2014, 17:20
... culture PATHAK et al: RUTA 6: A NOVEL TREATMENT FOR HUMAN BRAIN CANCER 978 Figure Histograms showing percentages of mitotic index (MI) and normal and abnormal metaphases of human brain cancer and ... mitotic catastrophe: A, normal metaphase spread from a control culture; B, endoreduplicated partial metaphase spread showing dicentrics, chromatid breaks, and tri-radial configurations; and C, an endoreduplicated ... Multani AS, Ozen M, Narayan S, Kumar V, Chandra J, McConkey DJ, Newman RA and Pathak S: Caspase-dependent apoptosis induced by telomere cleavage and TRF2 loss Neoplasia 2: 339-345, 2000 12 Pathak...
- 8
- 670
- 0
Báo cáo khoa học: "Spinal cord compression by a solitary metastasis from a low grade leydig cell tumour: a case report and review of the literature" pps
Ngày tải lên :
09/08/2014, 07:21
... anterior column also, via a lateral extracavitary approach (LECA) In our case, as the compression was mainly at the front an anterior approach with decompression and reconstruction was selected http://www.wjso.com/content/6/1/75 ... inflammatory and tumour markers, were within normal values and a dose of 16 mg Dexamethasone daily was started A CT guided biopsy was performed and the histological appearance of the lesion was ... wasn't feasible by surgical excision alone as it had already extended beyond the bony limits, postoperative radiotherapy with radical intent was applied The duration of the radiotherapy was a...
- 5
- 342
- 0
Báo cáo khoa học: " A case report of pseudoprogression followed by complete remission after proton-beam irradiation for a low-grade glioma in a teenager: the value of dynamic contrast-enhanced MRI" pptx
Ngày tải lên :
09/08/2014, 10:20
... Coefficients, and Image-Guided Histopathology with Special Attention to Radiation Necrosis Neurosurgery 2004, 54:1111-1119 Terakawa Y, Tsuyuguchi N, Iwai Y, Yamanaka K, Higashiyama S, Takami T, Ohata K: ... Spreafico F, Gandola L, Marchiano A, Simonetti F, Poggi G, Adduci A, Clerici CA, Luksch R, Biassoni V, Meazza C, Catania S, Terenziani M, Musumeci R, Fossati-Bellani F, Massimino M: Brain magnetic ... et al.: A case report of pseudoprogression followed by complete remission after proton-beam irradiation for a low- grade glioma in a teenager: the value of dynamic contrastenhanced MRI Radiation...
- 5
- 425
- 0
báo cáo khoa học: "Low-level expression of HER2 and CK19 in normal peripheral blood mononuclear cells: relevance for detection of circulating tumor cells" doc
Ngày tải lên :
10/08/2014, 22:20
... 6FAM-CGCCAGATCCAAGCACCTTCACCTT-TAMRA 3' 5' CCGCGACTACAGCCACTACTACAC 3' 5' GAGCCTGTTCCGTCTCAAA 3' 5' FAM-CGTGGTGCCACCATTGAGAACTCCAGGACCACG-BHQ1 3' Page of 10 (page number not for citation purposes) Journal of Hematology ... Forward Primer Her-2 Reverse Primer Her-2 Taqman Probe CK19 Forward Primer CK19 Reverse Primer CK19 FAM Beacon Probe 5' CCCAACCAGGCGCAGAT 3' 5' AGGGATCCAGATGCCCTTGTA 3' 5' 6FAM-CGCCAGATCCAAGCACCTTCACCTT-TAMRA ... considered as a 'virtual biopsy' of tumor tissue Metastatic Breast Cancer Patient Blood samples Blood samples were obtained from 120 untreated metastatic breast cancer patients on an IRB-approved trial...
- 10
- 335
- 0
Báo cáo y học: "Traditional electrosurgery and a low thermal injury dissection device yield different outcomes following bilateral skin-sparing mastectomy: a case report" ppt
Ngày tải lên :
10/08/2014, 23:21
... superficial vascular supply to impair skin flap viability [1] On the basis of infrared analysis, it has been demonstrated that the cutting surface of the PlasmaBlade operates at a temperature between ... and interpretation of data as well as critical review and final approval of this report for publication Author details WellStar Kennestone Hospital, 677 Church Street, Marietta, GA 30060, USA ... SS: Comparative healing of surgical incisions created by a standard “bovie,” the Utah Medical Epitome Electrode, and a BardParker cold scalpel blade in a porcine model: a pilot study Ann Plast Surg...
- 5
- 272
- 0
Báo cáo y học: " Solitary Peutz-Jeghers type hamartomatous polyps in the duodenum are not always associated with a low risk of cancer: two case reports" pptx
Ngày tải lên :
10/08/2014, 23:21
... a hamartomatous polyp with a focus of well-differentiated adenocarcinoma, and Case was a hamartomatous polyp with Table Twenty-seven cases of solitary duodenal Peutz-Jeghers type hamartomatous ... Peutz JLA: Very remarkable case of familial case of polyposis of mucous membrane of intestinal tract and nasopharynx accompanied by peculiar pigmentations of skin and mucous membrane Ned Maandschr ... well-differentiated adenocarcinoma (Figure 2) A colonoscopy and smallintestinal follow-through showed no other polyps Case is a 76-year-old Japanese man who had been treated for prostate, rectal and lung cancer,...
- 4
- 458
- 0
Báo cáo y học: " Arthritis, osteomyelitis, septicemia and meningitis caused by Klebsiella in a low-birth-weight newborn: a case report" pps
Ngày tải lên :
10/08/2014, 23:21
... Tabriz Al-Zahra Gynecology and Obstetrics Referral Hospital in Tabriz, Iran The parenteral third-generation cephalosporins appear to be a major therapeutic advance in the Ghorashi et al Journal ... hospital stay, decreased gestational age, prolonged use of broad-spectrum antibiotics and Table Laboratory tests and results on admissiona Complete blood cell count Biochemical analysis Arterial blood ... Tabriz Branch, Islamic Azad University, Tabriz, Ghorashi et al Journal of Medical Case Reports 2011, 5:241 http://www.jmedicalcasereports.com/content/5/1/241 Page of Iran 4Faculty of Health and...
- 4
- 341
- 0
Báo cáo y học: "Cerebral misery perfusion diagnosed using hypercapnic blood-oxygenation-level-dependent contrast functional magnetic resonance imaging: a case report" potx
Ngày tải lên :
11/08/2014, 11:23
... because no intramural haematoma was visible via a standard neck MRI He was discharged after making a good recovery at 12 days after he was admitted He was started on aspirin, dipyridamole and ... normocapnia and hypercapnia (during inhalation of 10% CO2) Using these images, CVR maps are generated, where an increase in BOLD signal is used as a marker of cerebral vasodilatory capacity Our patient ... References Baron JC, Bousser MG, Rey A, Guillard A, Comar D, Castaigne P: Reversal of focal “misery-perfusion syndrome” by extra-intracranial arterial bypass in hemodynamic cerebral ischemia: a case...
- 5
- 236
- 0
Báo cáo y học: " Tuberculosis contact investigation with a new, specific blood test in a low-incidence population containing a high proportion of BCG-vaccinated persons" pdf
Ngày tải lên :
12/08/2014, 16:20
... and the data interpretation KM recruited patients, obtained medical data and assessed results All authors read and approved the final manuscript Acknowledgements The authors would like to thank ... target 6-specific T cells at sites of active disease in pleural tuberculosis Clin Infect Dis 2005, 40:184-187 Mori T, Sakatani M, Yamagishi F, Takashima T, Kawabe Y, Nagao K, Shigeto E, Harada ... MD, Owiafe PK, Donkor SA, Hammond AS, Corrah T, Adegbola RA, McAdam KP, Brookes RH: Quantitative T cell assay reflects infectious load of Mycobacterium tuberculosis in an endemic case contact model...
- 9
- 434
- 0
Báo cáo y học: "Tight blood glucose control: a recommendation applicable to any critically ill patient" ppsx
Ngày tải lên :
12/08/2014, 20:20
... postoperative hyperglycaemia was not a risk factor for infectious complications Only by univariate analysis were they able to find an improvement in patients with blood glucose levels below 9.3 ... [7] In a retrospective study performed at one centre in Amsterdam, those authors found that, after oesophageal surgery in patients without significant cardiovascular compromise (ASA class I–II), ... mortality Infection rate, length of hospital stay Organ dysfunction, transfusion rate, length of ICU stay, infection rate APACHE, Acute Physiology and Chronic Health Evaluation; ICU, intensive care...
- 3
- 205
- 0
Báo cáo khoa học: "Blood glucose measurements in the critically ill: more than just a blood draw" doc
Ngày tải lên :
13/08/2014, 03:20
... intensive care unit patients Critically ill patients may have very low hematocrits, high or low arterial of venous oxygen tensions and may present extreme acid-base abnormalities, all of which have ... calibration for whole blood and plasma And just what is the standard reference method for glucose [10], and should there not be a reference method for each sample type - whole blood, plasma and ... higher glucose values in plasma compared to whole blood At the end of their discussion Corstjens and colleagues state the following: “our study has too few patients and therefore too little data points...
- 2
- 262
- 0
A low power high dynamic range broadband variable gain amplifier for an ultra wideband receiver
Ngày tải lên :
06/11/2012, 10:26
... Sanchez-Sinencio Laszlo Kish Charles S Lessard Costas Georghiades May 2006 Major Subject: Electrical Engineering iii ABSTRACT A Low Power, High Dynamic Range, Broadband Variable Gain Amplifier for an Ultra Wideband ... variation A differential pair can be linearized with diode-connected loads But in large gain cases, the linear range and bandwidth are limited A multiplier has good linearity and flexible tunablity ... can be justified that, in low voltage applications, the complementary differential pairs with source degeneration structure can achieve larger variable gain range than that of the differential...
- 121
- 386
- 0
Experimental study of operation performance of a low power thermoelectric cooling dehumidifier
Ngày tải lên :
05/09/2013, 16:10
... its applications to phase change phenomena Thermal Science and Engineering 2002, 10(6), 31-38 [12] Takata Y, Tanaka K, Kaijima K, et al Enhancement of heat transfer with liquid-vapor phase change ... Bejan A, Tsatusaronis G, Moran M Thermal design and optimization, Wiley, 1996 [10] Cengel YA Heat transfer- a practical approach, McGraw-Hill, 1998 [11] Takata Y Photo-induced hydrophilicity and ... cold-side fins appeared a slowly decreasing tendency, and finally reached a steady state It was also found that the relative humidity experienced two accelerating stages (i.e.98-90% and 70-50%) and two...
- 8
- 507
- 0
Case Study- A Date Class
Ngày tải lên :
29/09/2013, 07:20
... create an lvalue } // end function operator++ // overloaded postincrement operator; note that the dummy // integer parameter does not have a parameter name Date Date::operator++( int ) { Date ... // overloaded output operator 110 ostream &operator
- 11
- 350
- 0
Case Study- A String Class
Ngày tải lên :
29/09/2013, 07:20
... 150 151 // allocate temporary array for substring and // terminating null character char *tempPtr = new char[ len + ]; 152 153 154 155 // copy substring into char array and terminate string strncpy( ... right.sPtr // reclaim old space // assign new array to sPtr // assign new length to length // enables cascaded calls } // end function operator+= © 2003 Prentice Hall, Inc All rights reserved ... char * “to you”) assigning *s4Ptr to *s4Ptr operator= called Attempted assignment of a String to itself *s4Ptr = happy birthday to you 2003 Prentice Hall, Inc © Destructor: happy birthday toAll...
- 21
- 372
- 0
Báo cáo Y học: Characterization of a low redox potential laccase from the basidiomycete C30 pptx
Ngày tải lên :
08/03/2014, 09:20
... speculated from steady state analysis that laccases have a conserved O2 binding domain and that the rate of O2 reduction is dependent on that of substrate oxidation In our case, this means that LAC2 ... Cu/p-hydroxybenzoate) [15] The fungus was cultivated at 30 °C on a reciprocal shaker (50 r.p.m.) for days [15] Laccase activity The routine assay for laccase was based on syringaldazine oxidation in ... kinetic data on laccases from other fungi, it appears that while LAC1 activity is similar to other laccases for both phenolic and nonphenolic substrates, LAC2 is a remarkably efficient enzyme at least...
- 7
- 616
- 0
The Business Case for a Healthy Workplace potx
Ngày tải lên :
15/03/2014, 20:20
... psychological harassment.64 The province of Saskatchewan, Canada, followed Québec’s lead three years later, and in 2007 amended their Occupational Health and Safety Act to broaden the definition of harassment ... that it cannot be assumed that all acceptable safety measures are contained in this material or that additional measures may not be required in the conditions or circumstances that are applicable ... occupational health and safety hazards (for example, chemical, musculoskeletal, electrical and machine hazards) are recognized, assessed and controlled Personal Health Resources: Personal health...
- 17
- 673
- 2
Case handling: a new paradigm for business process support pot
Ngày tải lên :
15/03/2014, 21:20
... used to give an actor a handle to a case and not to a specific activity Once an actor has a handle to a case, she can select activities that are in state ready Note that authorization is governed ... Pallas Athena, Case Handling with FLOWer: Beyond Workflow, Pallas Athena BV, Apeldoorn, The Netherlands, 2002 [13] Pallas Athena, Flower User Manual, Pallas Athena BV, Apeldoorn, The Netherlands, ... free A1 A2 D4 A3 mandatory Skip mandatory R2 mandatory restricted mandatory D1 D2 D3 Fig Abstract example introducing the schema level of the case handling meta model mandatory for A1 , A2 and A3 ...
- 34
- 524
- 0