... Mucogingival pain Ostealgia m6 periosteal pain Cutaneous pain jyjpaln Deep pain — Migraine with aura Migraine without aura Cluster headache Paroxysmal unilateral headache Neurovascular variants Arteritis ... Vascular pain Episodic pain Paroxysmal neuralgia Glandular, ocular, and auricular pain Pulpaf pain Viscera! pain Visceral mucosal pain Physical pain Periodontal pain Connectivetissue pain Mucogingival ... individual's capacity for adaptation and compensation The adaptive and compensatory mechanisms are genetically determined and therefore remain relatively constant, except for a gradual decline with age...
Ngày tải lên: 06/03/2014, 11:20
... Peninsular Malaysia and the states of Sabah and Sarawak in the north of Kalimantan Kuala Lumpur, the national capital, Labuan UNEP/SCS – National Report Malaysia and Putra Jaya form the Federal territories ... meters and with a tidal stream of over knots The West Coast of Peninsular Malaysia has an equatorial climate, with an average annual rainfall of more than 2500mm and a daily temperature that ranges ... the Earth (Sahabat Alam Malaysia), World Wildlife Fund for Nature (Malaysia), Malaysian Institute of Marine Affairs (MIMA), Malaysian Nature Society, Malaysian Fisheries Society, Environmental...
Ngày tải lên: 06/03/2014, 15:21
Báo cáo khoa học: "Subcat-LMF: Fleshing out a standardized format for subcategorization frame interoperability" potx
... Human Language Technology and Empirical Methods in Natural Language Processing (HLT’05), pages 883–890, Vancouver, British Columbia, Canada Antonio Toral, Stefania Bracale, Monica Monachini, and ... International Conference on Language Resources and Evaluation (LREC), pages 43–47, Valletta, Malta Susan Windisch Brown, Dmitriy Dligach, and Martha Palmer 2011 VerbNet Class Assignment as a WSD Task ... Applications, pages 111–125, Berlin Heidelberg Springer-Verlag Aljoscha Burchardt, Katrin Erk, Anette Frank, Andrea Kowalski, Sebastian Pad´ , and Manfred Pinkal o 2006 The SALSA Corpus: a German...
Ngày tải lên: 17/03/2014, 22:20
báo cáo sinh học:" What impact do Global Health Initiatives have on human resources for antiretroviral treatment roll-out? A qualitative policy analysis of implementation processes in Zambia" pptx
... International Conference Center, Lusaka, Zambia; 2007 Kombe G: Human Resources for Health challenges in dealing with HIV/AIDS in Sub-Saharan Africa In Pan American Health Organization, World Health ... year to year There may also be a negative impact on long-term quality of care if top-ups are withdrawn after a year, and this underlines concerns about sustainability of the programmes An advisor ... directorate alongside a clinical care specialist employed by the Ministry of Health, but receive a higher salary While part of the provincial health team, they also have access to a small operational...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo khoa hoc:" Diagnosis of tuberculosis: the experience at a specialized diagnostic laboratory" pdf
... 355:1539-1550 Chauhan A, Chauhan DS, Parashar D, Gupta P, Sharma VD, Sachan AS, Gupta R, Agarawal BM, Katoch VM: DNA fingerprinting of Mycobacterium tuberculosis isolates from Agra region by IS ... SB analyzed the data PU performed and was responsible for the PCR and MODS assay, analyzed data and wrote the paper All authors read and approved the final manuscript Competing interests The authors ... diagnosis of smear-negative pulmonary tuberculosis J Clin Microbiol 2003, 41:3233-3240 Michael JS, Daley P, Kalaiselvan S, Latha A, Vijayakumar J, Mathai D, John KR, Pai M: Diagnostic accuracy...
Ngày tải lên: 11/08/2014, 07:21
Báo cáo y học: "Evaluation of a rapid diagnostic test, NanoSign® Influenza A/B Antigen, for detection of the 2009 pandemic influenza A/H1N1 viruses" pptx
... with a high sensitivity and specificity against seasonal influenza A viruses, including A/ H3N2, A/ H1N1 (seasonal) and H2N2 [17,18] This study evaluated the clinical accuracy and analytical sensitivity ... Diseases, National Agriculture Research Center, Kannondai 3-1-1, Tsukuba, Ibaraki 305-8517, Japan 5Department of Laboratory Medicine, National Health Insurance Corporation Ilsan Hospital, Goyang 410-719, ... City outbreak J Clin Virol 2009, 45:191-195 Sakai-Tagawa Y, Ozawa M, Tamura D, Le QM, Nidom CA, Sugaya N, Kawaoka Y: Sensitivity of influenza rapid diagnostic tests to H5N1 and 2009 pandemic H1N1...
Ngày tải lên: 12/08/2014, 01:22
Báo cáo y học: " Diagnosing asthma in general practice with portable exhaled nitric oxide measurement – results of a prospective diagnostic study" ppsx
... evaluate the diagnostic accuracy under clinical reality in primary care A solution for enhancing diagnostic accuracy might be found when adjusted norm values could be established as was postulated ... with at least ten pack years), and patients with asthma had positive bronchodilation response or positive bronchial provocation result That makes a false diagnostics improbable from a clinical ... during breathholding in humans Am J Respir Crit Care Med 1996, 153:829-836 Kostikas K, Papaioannou AI, Tanou K, Koutsokera A, Papala M, Gourgoulianis KI: Portable exhaled nitric oxide as a screening...
Ngày tải lên: 12/08/2014, 14:20
Báo cáo y học: "High mobility group box protein-1 (HMGB-1) as a new diagnostic marker in patients with acute appendicitis" potx
... value of C-reactive protein (CRP) determinations in patients with suspected acute appendicitis Ann Chir Gynaecol 1984, 73:281 Albayrak Y, Albayrak A, Albayrak F, et al: Mean Platelet Volume: A ... macrophages, neutrophils and platelets, and in turn mediates inflammation and enhanced cell motility Extracellular HMGB1 acts as a late mediator of inflammation Tracey and collaborators detected HMGB1 ... provide a diagnosis for patients who present with suspected AA, but have normal WBC counts Conclusions In conclusion, although many auxiliary diagnostic tools are available for diagnosis of AA, this...
Ngày tải lên: 13/08/2014, 23:20
CRH BP as a possible diagnostic marker for hepatocellular carcinoma
... 5' ACGGTTTTAAGAGGGGAAAGTC 3' 5' ACGAACCCCAAAAAACTACG 3' CRH-BP-UF CRH-BP-UR 5' GATGGTTTTAAGAGGGGAAAGTT 3' 5' AACAAACCCCAAAAAACTACA 3' 128 CRH-BP-f CRH-BP-r 5’ CCAGCATGTCGCCCAACTT 3’ 5’ CCTATTCCCTCGCAACCTG ... CCTATTCCCTCGCAACCTG 3’ 700 GAPDH-f GAPDH-r 5’ ACCACAGTCCATGCCATCA 3’ 5’ TCCACCACCCTGTTGCTGTA 3’ 453 HPRT1-f HPRT1-r 5’ ATGACCAGTCAACAGGGGAC 3’ 5’ CCAGCAAGCTTGCGACCTTGACCA 3’ 192 GW-CRH-BP-f 5’ AAA AAG CAG ... stomach Lymphoma FANCF BRCA1 APAF1 Ovary Ovary Malignant melanoma HMLH1 Ovary MGMT Ovary, glioma, lymphoma Breast Breast Breast, thyroid, gastric Pancreas Pancreas ERβ Maspin E-cadherin Reelin DAB1...
Ngày tải lên: 04/10/2015, 08:00
Assessing the Legal and Regulatory Context of a Corridor
... Created in 1981 by Bahrain, Kuwait, Oman, Qatar, Saudi Arabia, and the United Arab Emirates, the GCC had an ambitious program to establish a customs union and adopt a common currency To date, ... intra-SAARC trade 84 Trade and Transport Corridor Management Toolkit Bilateral agreements are more relevant to corridor operations in South Asia than multilateral instruments More than 15 bilateral ... by Armenia, Azerbaijan, Bulgaria, Georgia, the Islamic Republic of Iran, Kazakhstan, the Kyrgyz Republic, Moldova, Romania, Tajikistan, Turkey, Ukraine, and Uzbekistan, is a key Transport Corridor...
Ngày tải lên: 25/08/2016, 08:07
Corridor Diagnostic and Performance Assessment
... Main Inland Waterways of International Importance (AGN), the Trans-Asian Highway and 68 Trade and Transport Corridor Management Toolkit Trans-Asian Railway Agreements, and the International Agreements ... addressed? What health and other infrastructure is available along the corridor? Carrying Out a Corridor Diagnostic 39 that define technical norms, standards, and parameters for infrastructure.1 An alternative ... Road/ Rail in the Arab Mashreq The Transport Canada Corridors and Gateway initiative is described at http:// www.canadasgateways.gc.ca/nationalpolicy.html References Arnold, J 2012 Draft Vietnam:...
Ngày tải lên: 25/08/2016, 08:11
DSpace at VNU: Before it had a name: Diagnostic characteristics, geographic distribution, and the conservation of Cupressus tonkinensis (Cupressaceae)
... oligoneura Merr (Malpighiaceae), Bauhinia oxysepala Gagnep (Fabaceae), Bauhinia wallichii J F Macbr (Fabaceae), Beaumontia pitardii Tsiang (Apocynaceae), Cardiopteris quinqueloba Hassk (Cardiopteridaceae), ... Dischidia (Asclepiadaceae), Eria (Orchidaceae), Hoya (Asclepiadaceae), Impatiens (Balsaminaceae), Pyrrosia (Polypodiaceae), and Scleria (Cyperaceae) Associated conifers. A rich and distinct assemblage ... (Melastomataceae), Phyllanthus dongmoensis N N Thìn (Euphorbiaceae), Pistacia cucphuongensis T Ð Ðai (Anacardiaceae), Pistacia weinmannifolia Poiss ex Franch (Anacardiaceae), Schefflera pesavis...
Ngày tải lên: 16/12/2017, 04:01
Báo cáo y học: "Gain of a 500-fold sensitivity on an intravital MR Contrast Agent based on an endohedral Gadolinium-Cluster-Fullerene-Conjugate: A new chance in cancer diagnostics"
... of heavy ions demands absolute reliability of new diagnostics and treatment planning for prostate and brain tumors By the fact that the rare earth metals trapped inside of the carbon cage are ... Gd@C60[C(COOH)2]10 as a MRI contrast agent J Am Chem Soc 2003; 125: 5471-8 Okumura M, Mikawa M, Yokawa T, et al Evaluation of water-soluble metallofullerenes as MRI contrast agents Acad Radiol 2002; ... Then the organic phase was washed with water, followed by 1N-HCl and again water The organic layer was dried over Na2SO4 and evaporated The resulting residue was chromatographed on silicagel by elution...
Ngày tải lên: 26/10/2012, 09:07
Unit 8 Out and About A 1 -A 3
... book Ask and answer What is she doing? She is driving her car Ask and answer What are they doing? They are driving a car Ask and answer What is he doing? He is riding his motorbike Ask and answer ... What are they doing? They are ing… What are you doing? I am ing… What is he doing? He is driving his car Thur.Dec 2nd, 2010 Lesson 1: What are you doing? (A1 -3) Team A Team B start 10 What are ... Ask and answer What is he doing? He is riding his bike What is she doing? She is waiting for a train Ask and answer What is he doing? He is watching Tv Ask and answer What is he doing? He is reading...
Ngày tải lên: 23/10/2013, 08:11
How to get out of the friendzone: turn your friendship into a relationship
... Sam ran into Katie, who threw her arms around him and whispered that they needed to talk; she’d heard he was dating someone and wanted to know all about it After hearing about Cara, Katie badmouthed ... met Cara at his coed dodgeball tournament She was pretty and nice and seemed to like him back They started dating and things were going well At a party soon after Sam and Cara started seeing each ... 43 James sends Tiana an Internet video of a cat wearing mittens and sliding all over the kitchen floor Tiana responds with a video of a Maltipoo in a teacup P.M Tiana’s cubicle mate, Laura, asks...
Ngày tải lên: 10/02/2014, 18:17
Tài liệu Báo cáo khoa học: a-enolase: a promising therapeutic and diagnostic tumor target ppt
... antigens Cancer Chemother Pharmacol 46(Suppl), S86–S90 132 Kondo H, Sahara H, Miyazaki A, Nabeta Y, Hirohashi Y, Kanaseki T, Yamaguchi A, Yamada N, Hirayama K, Suzuki M et al (2002) Natural antigenic ... pancreatic cancer by alpha-enolase, a novel pancreatic ductal adenocarcinoma-associated antigen Int J Cancer 125, 639–648 He P, Naka T, Serada S, Fujimoto M, Tanaka T, Hashimoto S, Shima Y, Yamadori ... strategici su tematiche di interesse regionale o sovra regionale (IMMONC), Ricerca Sanitaria Finalizzata, Ricerca Sanitaria Applicata; Ribovax Biotechnologies (Geneva, Switzerland) and Fondazione...
Ngày tải lên: 14/02/2014, 19:20
Tài liệu Linking the Gaza Strip with the West Bank: Implications of a Palestinian Corridor Across Israel docx
... Bank and Gaza total area is 2,316 sq.mi.) Persian Gulf South China Sea Manama Malaysia Indonesia Brunei 2,227 sq.mi Malaysia Gulf of Bahrain Qatar page 45 Bandar Seri Begawan Saudi Arabia Bahrain ... of Oman U .A. E South Atlantic Ocean Democratic Republic of Congo Luanda Muskat Oman Angola Russian Federation Argentina Chile Atlantic Ocean Gulf of Riga Latvia Riga Lithuania Kaliningrad Oblast ... the war was the impact of a major hurricane that affected East Pakistan The apathy of the West Pakistani leadership and their failure to aid East Pakistan only aggravated an already tense situation...
Ngày tải lên: 16/02/2014, 11:20
Tài liệu Enhancement of aesthetic treatment planning and communication using a diagnostic mock-up pptx
... template or a diagnostic mock-up It is an advantageous diagnostic tool and a great communication method to help the patient visualise the anticipated outcome in three dimensions and intra-orally, ... mock-up can help in determining the correct shade for direct composite resin restorations and can serve as a practical chairside alternative to the diagnostic wax-up It can also be used to create a ... restorations and to explain the limitations, thus avoiding the frustration that may result from miscommunication The diagnostic mock-up is a fairly simple and fast procedure that can enhance the satisfaction...
Ngày tải lên: 19/02/2014, 17:20
Tài liệu Hemodynamics – New Diagnostic and Therapeutic Approaches Edited by A. Seda Artis pdf
... calculate an output variable from other input variables and parameters The structural analysis by ISM classifies variables and parameters in accordance with the hierarchical levels, which are obtained ... input variables which can reach to the output are found into the hierarchical graph, and an input variable whose path to the output has the maximum total gain is proposed as a causative one for adjusting ... replaced by a path corresponding to the product, and the intermediate variable is eliminated However, it may happen that an output variable is also used as an intermediate variable The output variable...
Ngày tải lên: 19/02/2014, 23:20