call to call a variable function with arguments

... conventional parameter apparatus such as temperature, pH and conductance etc., and water quality analysis apparatus such as NH4+-N, PO43—P and COD etc The instruments should be maintained regularly, ... the anaerobic (total length: 51m), anoxic (total length: 85.9m) and aerobic (total length: 331.1m) tanks after simple pretreatment without primary sedimentation tank The reversed anaerobic and anoxic ... instruments in Qinghe WWTP Locatio Apparatus for Apparatus for water quality analysis n* conventional parameters Flowmeter/ Liquid Multi -function water quality analysis apparatus (for pH, T, level BOD5,...

Ngày tải lên: 05/09/2013, 09:08

... the hand path evolved systematically toward an attractor path during "forgetting" then this measure should have decreased systematically (as the hand path was drawn toward the attractor path) ... 2001:14-17 Marayong P, Okamura AM: Speed-accuracy characteristics of human-machine cooperative manipulation using virtual fixtures with variable admittance Hum Factors 2004, 46:518-532 Bettini A, Marayong ... that this was indeed the case, for both visual and haptic training The tracing error relative to the last reach decreased systematically and significantly during the recall phase (ANOVA, linear...

Ngày tải lên: 19/06/2014, 10:20

... that has all the good stuff in it organized in an easy to understand way and that people can reference That's EASILY worth $7 More to the point - it's easier for you to research and create a ... use a program like Rapid Action Profits to set it up so that an affiliate gets instantly paid into their PayPal account 100% of the $7 sale Why would you go and that? Are you crazy? Only like a ... related to WordPress And see what questions come up over and over and over again Then you create a report Each short chapter is an answer to a major problem people keep asking over and over again...

Ngày tải lên: 27/06/2014, 23:20

... of a valved-graft A coronary artery bypass grafting with a saphenous vein graft anastomosed in the right coronary artery at the level of the crux was also done The patient was rewarmed and weaned ... substantial contributions of data analysis, AM has made substantial contributions to design the manuscript and DA has made substantial contribution to design and has given the final approval of ... C: Proximal aortic dissection with coronary malperfusion: presentation, management and outcome C J Thorac Cardiovascular Surg 2001, 121:552-60 Kawahito K, Adachi H, Murata S, Yamaguchi A, Ino T:...

Ngày tải lên: 10/08/2014, 09:22

... forms as the training/evaluation data The evaluation metrics used in the abbreviation generation are exact-match accuracy (hereinafter accuracy), including top-1 accuracy, top-2 accuracy, and top-3 ... problem, as compared to the generation problem Eytan Adar 2004 SaRAD: A simple and robust abbreviation dictionary Bioinformatics, 20(4):527– 533 Hiroko Ao and Toshihisa Takagi 2005 ALICE: An algorithm ... CVPR’07, pages 1–8 Hong Yu, Won Kim, Vasileios Hatzivassiloglou, and John Wilbur 2006 A large scale, corpus-based approach for automatically disambiguating biomedical abbreviations ACM Transactions...

Ngày tải lên: 17/03/2014, 01:20

... identical to an L5 DNA region harboring L5 gp64 gene and an upstream operator (5'GGTGGATGTCAAG) [10] In this communication, we have designated the L1 DNA fragments carrying operators 5'GGTGGATGTCAAG ... studies in fact revealed that affinity of CI to a 21 bp DNA fragment (carrying 5'GGTGGATGTCAAG) is about 2.57 fold higher than that to another 21 bp DNA fragment harboring 5'GGTGGCTGTCAAG (data not ... (His-CI), a vector pSAU1180 was constructed by cloning an L1 DNA [12,17] (amplified with primers, LCP2: 5'AAGCTTCCTTTCGTTGCGCGGC and LCP3: 5'GAATTCATGAGCGGCAAAATC) to pET2 8a (Novagen, USA) This...

Ngày tải lên: 18/06/2014, 18:20

... identical to an L5 DNA region harboring L5 gp64 gene and an upstream operator (5'GGTGGATGTCAAG) [10] In this communication, we have designated the L1 DNA fragments carrying operators 5'GGTGGATGTCAAG ... studies in fact revealed that affinity of CI to a 21 bp DNA fragment (carrying 5'GGTGGATGTCAAG) is about 2.57 fold higher than that to another 21 bp DNA fragment harboring 5'GGTGGCTGTCAAG (data not ... (His-CI), a vector pSAU1180 was constructed by cloning an L1 DNA [12,17] (amplified with primers, LCP2: 5'AAGCTTCCTTTCGTTGCGCGGC and LCP3: 5'GAATTCATGAGCGGCAAAATC) to pET2 8a (Novagen, USA) This...

Ngày tải lên: 20/06/2014, 01:20

... Srinivasan L, Thara R, Tirupati SN: Cognitive dysfunction and associated factors in patients with chronic schizophrenia Indian J Psychiatry 2005, 47:139-143 Ananthanarayanan CV, Janakiramaiah N, Gangadhar ... http://www.annals-general-psychiatry.com/content/6/1/19 Table 3: Correlation (Spearmans) among variables Age Digit forward Digit backward Immediate recall Delayed recall Verbal retention: similar pairs ... (tests the ability to inhibit an inappropriate response to tasks anticipated to elicit a false alarm motor response), and prehension behavior (checks the environmental autonomy) Disability assessment...

Ngày tải lên: 08/08/2014, 23:20

... factor beta upregulates 5-lipoxygenase activity during myeloid cell maturation Proc Natl Acad Sci USA 1993, 90:5984-5988 47 Futani H, Okayama A, Matsui K, Kashiwamura S, Sasaki T, Hada T, Nakanishi ... an agarose gel and revealed by ultraviolet detection Densitometric analysis was performed for each amplimer against that for GAPDH with a ChemiImager 4000 (Alpha Innotech Corporation, San Leandro, ... was extracted with TRIzol™ reagent (Invitrogen, Burlington, Ontario, Canada) in accordance with the manufacturer's specifications and than treated with the DNA-free™ DNase Treatment and Removal...

Ngày tải lên: 09/08/2014, 08:23

... a cadaveric study Foot Ankle Int 2003, 24:780 Sarrafian S: Anatomy of the foot and ankle: descriptive, topographic, functional 2nd edition Philadelphia: Lippincott; 1993 Agur A, Dalley A: Grant's ... JW and DET critically revised the manuscript All authors read and approved the final manuscript Additional material Additional file Posterior approach A video demonstration of the posterior approach ... seventy-eight patients assessed over an 11-year period They reported approximately 1/3 of varus deformities linked with cerebral palsy are associated with TP alone and a further 1/3 are associated with abnormal...

Ngày tải lên: 10/08/2014, 21:23

Ngày tải lên: 28/08/2016, 21:46

... can get acquainted with the ballot more quickly and shorten the task over each sample evaluation We compared this alphabetized approach with a randomized attribute presentation and found that ... chocolate, vanilla ice cream, fried chicken and mashed potatoes and gravy Pizza and chocolate produced the strongest emotions based on Analysis of Variance The terms active, adventurous, affectionate, ... included approximately equal percentages of males and females, and the age range was from 18 to 65 years of age Basically consumers are screened and recruited via internet and/or phone based on...

Ngày tải lên: 03/04/2013, 21:07

... time available/ in the available time.(1) We have to exploit all available potential/ all potential available in our country (2) As we know that when changing the position of adjective available ... should be washed everyday Nguyễn Thị Nga K 1 1A 19 Graduation paper 2.2.5 Exclamatory adjective sentence An adjective as head of an adjective phrase or as its sole realization can be an exclamation: ... up to now C .A plays an important role in learning a foreign language as a main subject at most language universals According to C James (1980;19), C .A is a form of inter-language study and a central...

Ngày tải lên: 10/04/2013, 14:46

... Sundays, many families have a traditional meat at home: grilled meat with potatoes, vegetables and gravy For many English people, dinner is a main meal and the whole family often have dinner together ... by an amount of water or steam in a confined space For example: They kept up a good head of steam 16 (in place names) a headland For example: Beach head 17 A main division in a lecture, an essay, ... Similarly, when we say not beat a dead horse we not refer to a carcass of a certain kind of animal but what we mean is that a person should not waste time thinking of an issue that has already...

Ngày tải lên: 20/12/2013, 18:33

... virtual hardware resources, as well as an operating system and all its applications, inside a software package Encapsulation makes virtual machines incredibly portable and easy to manage, and VMware ... from an operational failback Capacity Management Capacity management was a concern; for example, what happens if an operational load is moved to a second site with its own operational load? Network ... manage the resources to be applied to the appropriate functions, say mix between: development/application and database So this is a fairly automatic and straight forward mapping Organizationally,...

Ngày tải lên: 18/02/2014, 00:20

... 5¢-GCTTCAGTACTTAGAGAC 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACC 5¢-GAAAAAAGGGGCCACTCAGG 5¢-T(18)GAAAAAAGGGGCCACTCAGG 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTG 5¢-C(18)GAAAAAAGGGGCCACTCAGG 5¢-G(18)GAAAAAAGGGGCCACTCAGG ... Forward Reverse Reverse Reverse Forward Reverse 5¢-TAATTAACCCTCACTAAAGGGGTGCTCGGCATAAG 5¢-GCCATGAATATCTCCAACGAG 5¢-CATCCAAAATACGCCATGAATATC 5¢-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCG 5¢-GCTTCAGTACTTAGAGAC ... 5¢-G(18)GAAAAAAGGGGCCACTCAGG 5¢-GAATTGCTGCCGTCAGCTTGA 5¢-TAATTAACCCTCACTAAAGGGAAACGGAGCGGCACCTCTT 5¢-GCGGATCCTGGACCGCAAAAG ompA* ompA105 ompA117 5¢rpsO 5¢rpsO 3¢rpsO 3¢rpsO 3¢rpsO-(T)18 rpsO internal 3¢rpsO-(C)18...

Ngày tải lên: 19/02/2014, 16:20

... Y and Maeda E 2003 Hierarchical Directed Acyclic Graph Kernel: Methods for Structured Natural Language Data ACL-2003 Zelenko D., Aone C and Richardella A 2003 Kernel Methods for Relation Extraction ... 2004 data shows consistent better performance on all setups than the 2003 data although the ACE 2003 data is two times larger than the ACE 2004 data This may be due to two reasons: 1) The ACE 2004 ... POS tagging, NE tagging, syntactic parsing, template extraction and relation extraction using a generative model Feature-based methods (Kambhatla, 2004; Zhou et al., 2005; Zhao and Grishman, 20052...

Ngày tải lên: 20/02/2014, 12:20

Ngày tải lên: 05/03/2014, 16:20

... Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Betaproteobacteria Proteobacteria, Betaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria ... (strain ADP1) Pseudomonas fluorescens Pf5 ATCC BAA-477 Actinobacteria, Actinobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria ... characteristics of transthyretins and TLPs are indicated above the alignment: motifs A –C’ are indicated with straight lines and are labelled; b-strands are indicated with arrows and are labelled...

Ngày tải lên: 07/03/2014, 00:20

... necessarily mean that translation starts from a downstream AUG, as predicted by genome and mRNA analysis, but raises the possibility that the translated form may have used a CUG start codon with an ... from an 83-year-old man and a 71.0 g sample of occipital cortex from a 85-year-old man with a short (25 h) post mortem delay RNA isolation, reverse transcription and 5Â-RACE Total RNA was isolated ... concentrated by Amicon ultraltration (Millipore, Billerica, MA, USA) Different antigens were used to characterize immunoserologically the mAbs raised against the protease domain (mAb B1 and mAb ...

Ngày tải lên: 07/03/2014, 10:20