call of a subroutine in page 1 from page 0

... hospitals with 14 0, 000 sick-beds and 10 ,00 0 medical stations Out of 2.5 kg wastes eliminated from each sick-bed per day, 10 -15 % is harmful wastes, which include dressing of wounds, syringes, sharp ... economics had manual incinerator In other hospitals, the manual incinerator is burned and leaves an uncomfortable smell According to the “Regulation of medical waste management” of the Ministry of Public ... regulations There have been many sanitation workers dumping waste bags to roadsides In particular, Hanoi has thousands of medical stations, making up about 2% of total wastes Only 60 hospitals and...

Ngày tải lên: 23/09/2012, 15:38

... methods and equivalences in general and translation of ESP as well as technical translation in detail Chapter is an investigation on translation of related terms in Industrial paint from English into ... noun is a main word and adjective is supporting word In industrial painting field, power agitator has an important role in mixing paint In this case, the reader can not find out the meaning of “power” ... anti-fouling paint mentioned above The marine paints vary in color and types The typical characteristics of marine paints are water proofing and high-pressured resistance Beside the ability of...

Ngày tải lên: 11/12/2013, 23:55

... 1. 8 C2 86.43 42.56 74.26 11 0 .19 10 814 0 304 08 11 .4 (38 .1* ) 10 0 ( 10 0* ) 6 .0 (1. 9*) 11 .57 3.7 16 .0 19 .3 ˚ *Outer shell: 1. 9 1. 8 A gonal plates growing in bundles, and were up to ˚ 0. 2 · 0 .1 · 0. 02 ... N-terminal pro domain is autocatalytically cleaved off when the enzyme has obtained its active conformation, and the two C-terminal domains are cleaved off by heat treatment at 50 °C An Ala-Pro-Thr ... Crystallogr D 50, 7 60 763 Vagin A & Teplyakov A (19 97) MOLREP: an automated program for molecular replacement J Appl Crystallogr 30, 10 22 10 25 Perrakis A, Harkiolaki M, Wilson KS & Lamzin VS ( 20 01 ) ...

Ngày tải lên: 19/02/2014, 07:20

... Factor Analysis 0, 80 0, 60 no financial limit financial posit good / normal 0, 40 Vertical Axis F dde limit 0, 20 ord book low prod low -0, 80 cap utilis low -0, 60 -0, 40 -0, 20 0 ,00 losses 0, 00 barter ... R2 -0, 000 089 43, 60 0 ,18 49 (-2 ,00 ) -0, 319 (-3,56) -0, 26 (-2, 81) -0, 000 088 (-2 ,05 ) 47,26 0, 200 4 B: Sub-groups & (right-hand half of Graph 1) Capacityf2 No-debt Labour Khi(2) Pseudo Utilizationa R2 ... certainty See Qian (19 94), Dewatripont and Maskin (19 95), Earle and alii (19 96), Earle and alii (19 97), Berglửf and Roland (19 98), Bai and Wang (19 98) For an analysis of the shortcomings and measurement...

Ngày tải lên: 06/03/2014, 08:20

... AACGACGATGAAAACGCCGGCGAGGTGGCGGATCGTGATCCGGTG CTTCTAGTATCTGGAATTGGAGGCTCTATTCTGCATTCTAAGAAGA AGAATTCAAAGTCTGAAATTCGGGTTTG TATATAGGTACCTTAACCAGAATCAACTACTTTGTG ATATATGGATCCATGGGCTGGATTCCGTGTC TATATAGGTACCTTACTTGTCATCGTCGTCCTTGTAGTCACCAGA ... (Lactuca sativa EST BQ864 6 10 ); MtLCAT1 (M truncatula AF5337 71) ; AtLCAT2 (A thaliana NP _17 1897, comes from At1g04 01 0 ); MtLCAT2 (M truncatula AF49 315 9); AtPDAT2 (A thaliana NP _19 00 69, comes from ... below and that with the complementary sequence Number Gene cloning ATATATGGATCCATGTCTCTATTACTGG AAGAGATC TATATAGGTACCTTATGCATCAACAGAGACACTTAC ATATATGGATCCATGGGCTGGATTCCGTGTCCGTGCTGGGGAACC AACGACGATGAAAACGCCGGCGAGGTGGCGGATCGTGATCCGGTG...

Ngày tải lên: 30/03/2014, 15:20

...

Ngày tải lên: 18/06/2014, 19:20

... 13 17 15 17 10 (T8) 15 (L2) 10 10 10 13 400 16 1.2 33 35 4 40 16 1.6 33 45 4 40 16 1.7 33 43 (based on Risser and static height for months) was started after 10 months of bracing and exercise, and ... of RSC bracing and subsequently 10 (T8) 15 (L1) 10 15 10 15 3 90 15 9.3 4 70 15 8 24 50 4 80 15 9 31 51 Cobb angle deteriorated by degrees and scoliometer readings reverted to baseline levels The patient ... staging of skeletal maturation is apophyseal image variation according to the radiological view The appearance of the iliac apophysis on posterior-anterior X-rays cannot be used as a reliable indicator...

Ngày tải lên: 11/08/2014, 17:21

... Brazilian isolates (F1 BR. 01 . 01 BR125 and F1.BR. 01 . 01 BR087) supported by 10 0% aLRT values Isolate 06 BR FPS5 61 formed a rigid subcluster (94% aLRT) with two strains (F1.JP. 200 4 DR 619 0 and F1.JP. 200 4.DR 608 2) ... 99UFRJ -16 and DQ3588 01 ; 01 BR087) and two isolates from Japan (GenBank: AB4 802 99; F1 JP. 200 4.DR 608 2 and AB4 803 01 ; F1.JP. 200 4.DR 619 0) It is to be noted that, as a result of our current analysis, ... State, Brazil AIDS 200 8, 22:433-435 Santos AF, Sousa TM, Soares EA, Sanabani S, Martinez AM, Sprinz E, Silveira J, Sabino EC, Tanuri A, Soares MA: Characterization of a new circulating recombinant...

Ngày tải lên: 12/08/2014, 04:20

... -4 .11 7 (0. 539) < 0. 000 1a 1. 472 (0. 009 , 2.935) 0. 049 Prolastin (n = 36) Placebo (n = 35) -2 .11 5 ± 7.937 -1. 911 (0. 788) 0. 01 8 1a -3.289 ± 5.949 -3. 313 (0. 8 01 ) 0. 000 1a 1. 402 ( -0. 782, 3.586) 0. 204 ... Prolastin (n = 36) Placebo (n = 35) 1. 7 61 ± 4. 511 1. 643 (0. 508 ) 0. 0 01 9a 2. 209 ± 3.378 2.254 (0. 517 ) < 0. 000 1a -0. 611 (-2. 01 9 , 0. 797) 0. 389 Prolastin (n = 36) Placebo (n = 35) 1. 994 ± 3. 307 1. 924 ... 1. 924 (0. 411 ) < 0. 000 1a 2. 315 ± 2.578 2.356 (0. 4 20) < 0. 000 1a -0. 432 ( -1. 573, 0. 709 ) 0. 452 PD15, 15 th percentile lung density; CT, computed tomography; SD, standard deviation; LS mean, least squares...

Ngày tải lên: 12/08/2014, 14:20

... linear analog of NYAD2 01 (NYAD- 209 ) and a mutant analog of NYAD-2 01 (NYAD-233) after mutating two key dimer-interface residues, W18 4A and M18 5A CD analysis confirmed that NYAD-2 01 and the mutant ... http://www.retrovirology.com/content/8 /1/ 28 Page 10 of 18 Table Antiviral activity (IC 50) and cytotoxicity (CC 50) of NYAD-2 01 , NYAD- 202 and NYAD- 203 in laboratory-adapted and primary HIV -1 isolates HIV -1 virus Subtype ... an adaptive protein-protein interface Proc Natl Acad Sci USA 200 3, 10 0 :16 03 -16 08 52 Arkin MR, Wells JA: Small-molecule inhibitors of protein-protein interactions: progressing towards the dream...

Ngày tải lên: 13/08/2014, 01:20

... Page of 11 (page number not for citation purposes) Retrovirology 200 6, 3:84 for approximately 18 hours, spun at 12 00 rpm for 10 and resuspended in fresh media containing saquinavir (1 µM final ... Antimicrob Agents Chemother 200 5, 49 :11 13 -11 19 Perez-Alvarez L, Carmona R, Ocampo A, Asorey A, Miralles C, Perez C, Pinilla M, Contreras G, Taboada JA, Najera R: Long-term monitoring of genotypic and ... step of at 68°C The PCR was performed with 50 ng sense and antisense primers (WS1, 5'-ATAAGCTTAGCAGAAGACA-3', and 3'envMD4, 5'-GCAAAATCCTTTCCAAGCCC-3') in a 50 µl PCR reaction DNA products were analysed...

Ngày tải lên: 13/08/2014, 09:20

... result is that the 10 11 12 13 Ding SW, Li H, Lu R, Li F, Li WX: RNA silencing: a conserved antiviral immunity of plants and animals Virus Res 200 4, 10 2 : 10 9 -11 5 Karpala AJ, Doran TJ, Bean AG: Immune ... Broitman-Maduro G, Li WX, Ding SW: Animal virus replication and RNAi-mediated antiviral silencing in Caenorhabditis elegans Nature 200 5, 436 : 10 40 - 10 43 Mak J: RNA interference: more than a research ... siRNAs, suggesting a specificity of action [ 10 ] Adenovirus VA RNAI and VA RNAII are cleaved by Dicer and act as RNAi suppressors [13 ] Both Tat protein and VA RNAs inhibit Dicer activity A striking...

Ngày tải lên: 13/08/2014, 09:21

... 3 . 10 ) < 0. 0 01 1. 41 (0. 96 to 2 .08 ) 0. 083 Loneliness 2 .08 (1. 67 to 2.59) < 0. 0 01 1.94 (1. 42 to 2.64) < 0. 0 01 1.56 (1. 27 to 1. 91) < 0. 0 01 0. 93 (0. 71 to 1. 23) 0. 613 0. 837 Victimization Promoting factors ... Loneliness 1. 61 (1. 32 to 1. 98) < 0. 0 01 1.47 (1. 10 to 1. 96) 0. 01 0 Victimization 1. 57 (1. 29 to 1. 91) < 0. 0 01 1 . 10 (0. 84 to 1. 44) 0. 486 School work enjoyment 0. 82 (0. 65 to 1. 03 ) 0. 085 0. 99 (0. 75 to 1. 30) ... (1. 13 to 1. 84) 0. 003 1. 10 (0. 81 to 1. 48) 0. 542 Disturbed work Bothered during lessons 1. 43 (1. 19 to 1. 73) 1. 90 (1. 41 to 2.58) < 0. 0 01 < 0. 0 01 1.24 (0. 98 to 1. 57) 1. 28 (0. 88 to 1. 85) 0. 0 71 0 .19 8...

Ngày tải lên: 13/08/2014, 18:21

... http://snap.nl.sg/details /08 000 0878 _00 01 . html, accessed 15 July 2 01 1 Figure 10 : Postcard titled “Municipal Building, Singapore”, c .19 34 Source: Cheah Jin Seng Singapore: 500 Early Postcards (Singapore: ... The Mask of Continuity 2.3 Billboard 11 0 14 1 2.3 .1 The Façade As Image 14 3 2.3.2 An Ambivalent Mask 15 2 2.3.3 The Mask of Openness 17 3 Chapter – MASKING: A REVEALING VEIL 204 Bibliography 208 Appendix ... accessed on 21 March 2 01 1 Figure 3: Façade of the National Arts Gallery Source: National Arts Gallery, Singapore “Winning Design” Available from: http://www/nationalartgallery.sg/winning.html, accessed...

Ngày tải lên: 12/10/2015, 17:36

... constructs a Data Definition Language (DDL) statement to create a table in a SQL Server database from the schema of a DataTable The complete statement that is generated is shown in Example 10 -16 Example ... ConfigurationSettings.AppSettings["Sql_ConnectString"]); MessageBox.Show("Table " + TABLENAME + " created.", "Create DataTable from schema.", MessageBoxButtons.OK, MessageBoxIcon.Information); } private void CreateTableFromSchema(DataTable ... collection of columns exposed by the PrimaryKey property of the table to add the columns to the command If you have a number of tables in a DataSet that you want to create in a database, you can iterate...

Ngày tải lên: 21/01/2014, 11:20

... girl from sitting close together on the wide sofa and looking over portfolios of steel engravings from famous paintings and talking of nothing in particular, or at least not of the steel engravings ... possible relation between these two without feeling rather foolish They decided again and again that it was nothing, but just as often they again began wondering what it was.And the fear of making themselves ... intention of going abroad for a year or two; whereupon Jack, averring that he was not cut out for a lawyer, and that he was tired of getting his essays on things in general back from the magazines, decided...

Ngày tải lên: 17/02/2014, 19:20

... 7 10 –728 757–778 AAG AGC GCA ACT GAT AGT GCA TCC GCC ATC GAC GCA ATT AGC CTT GCT AGC AGT ACG AGG 613 –6 30 822–839 706 –723 466–483 AAG AGC AAA GAT GAT AGT GAT TAC GCC ATC CCA CAG ATT AGC ATC AAT ... widespread in the Archaea and Bacteria domains [11 ] Among the broad range of physiological processes in which they participate, CA can play a significant role in autotrophic organisms, serving as an inorganic ... had an affinity of 13 .9 mmolÆL )1 and an activity of 253.7 lmol CO2Æmin )1 g )1 wet weight CA from the trophosome tissue had an affinity of 7.2 mmolÆL )1 and an activity of 10 9.4 lmol CO2Æmin )1 g)1...

Ngày tải lên: 18/02/2014, 16:20

... ⁄ 20 23 30 15 ⁄ 15 15 (16 ⁄ 7) ( 10 ⁄ 13 ) (7 ⁄ 8) 10 15 2 87 23 262 10 11 5 4989 31 695 18 6 01 157 68 10 235 10 07 9 502 4 32 01 3 19 288 16 1 76 30 267 9822 4732 31 714 19 234 An interaction is assigned ... bonds Main chain–main chain Main chain–side chain Side chain–side chain Total ˚ Exposed surface areab (A2 ) ˚ Apolarc (A2 ) ˚ Buried surface areab (A2 ) ˚ Apolarc (A2 ) a 1IC6 1THM 38 24 ⁄ 14 23 38 18 ... D98–K94 D 112 –R147 D 117 –R1 21 D184–R188 D2 60 R12 1THM 2.77 4.65 3.93 2.95 2.75 2.76 2.94 3 .02 3 .02 ˚ A ˚ A) a ˚ A ˚ A ˚ A ˚ A ˚ A ˚ A ˚ A D57–R 102 D 60 R 102 D188–K17 E28–K95 D124–K153 D188–R2 70 D2 01 R249...

Ngày tải lên: 19/02/2014, 16:20

... transmembrane helices, cofactor binding sites, sequence identities) or obtained experimentally (apparent molecular mass, cofactor content) Gene AF 502 AF5 01 AF499 AF 503 AF 500 Apparent/calculated ... eluted after 12 0 mL (peak maximum) These fractions were applied to a Mono Q anion-exchange column (HR 10 / 10 ) equilibrated with buffer A Protein was eluted using a linear NaCl gradient (0 1 M, 10 0 ... Ôtwin-arginineÕ signal sequence that is characteristic of cofactor-containing proteins translocated into the periplasm via the Tat translocase [27] As deduced from the N-terminal sequence of AF499,...

Ngày tải lên: 21/02/2014, 03:20

... (From Jan 2 01 3 ) to 10 0 S$ 20, 000 10 1 to 12 0 S $15 ,00 0 12 1 to 14 0 S $ 10 ,00 0 14 1 to 16 0 S$5 ,00 0 S $0 16 1 to 2 10 211 to 2 30 2 31 to 2 50 2 51 to 2 70 2 71 and above - Surcharge (From Jul 2 01 3 ) S $0 S$5 ,00 0 ... will incur a corresponding registration surcharge of between S$5 ,00 0 and S$ 20, 000 Details of CEV bandings are as follows: Band A1 A2 A3 A4 B C1 C2 C3 C4 CEV BANDINGS FOR CAR Carbon emission Rebate ... Cash payable to Land Transport Authority If you need assistance, please call LTA's Customer Service hotline at Tel: 18 00 -CALL LTA (18 00 -2255 582) Printing date: 10 September 2 01 2 The information...

Ngày tải lên: 07/03/2014, 11:20