cag repeat polymorphism in the androgen receptor gene and male infertility

... nuclear receptors The androgen receptor The polymorphic region of CAG repeats in the androgen receptor gene CHAPTER 1: CAG REPEAT POLYMORPHISM IN THE 17 ANDROGEN RECEPTOR GENE AND MALE INFERTILITY INTRODUCTION ... bp, and the GGC repeats stretch at position 1347 bp 10 CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA G (CAG) n (GGC)n No of bp 174 1347 1611 11 Conservation of segments of the ... histones and chromatin The polymorphic region of CAG repeats in the androgen receptor gene 3.1 Description The AR gene contains a polymorphic stretch of CAG triplets in the exon The CAG repeats,...

Ngày tải lên: 11/09/2015, 09:05

... cis-acting elements in the 5′flanking region of the HO-1 gene have not been identified [35,36] Exactly how arsenic exposure in humans interacts with the (GT)n repeats in the HO-1 gene promoter and ... presents the frequency distribution and the ageand gender-adjusted ORs with the 95% CIs for the classic risk factors for the patient and control groups of the two cohorts Aging and being male gender ... USA) The 5′-flanking region containing the (GT)n repeats of the HO-1 gene was amplified by the polymerase chain reaction (PCR) with a FAM-labeled sense primer, 5′-AGAGCCTGCAG CTTCTCAGA-3′, and...

Ngày tải lên: 10/08/2014, 05:21

... subjects, and the protective gene effect appeared in the stratified high risk group, not in the low risk group The significant increases of genotype L than S indicated the protective genetic effects ... is, the levels of HDL-C, it may explain the controversial findings in the literatures Similar as the previous CAD studies, we did not find the significant difference of averaged (GT)n repeats in ... genotype in HO-1 gene promoter, thereby reducing the risk of cerebral ischemia In this study, the allelic frequency distribution of the lengths of (GT)n repeats in the HO-1 promoter in recruited...

Ngày tải lên: 10/08/2014, 05:21

... affiliated to the Medical School of Nanjing University All subjects studied in the study were Chinese Han living in and around Nanjing No subjects dropped out during the process of the study The study ... contributed to the final manuscript In addition, DS and JD genotyped the samples and participated in the design and analysis of the study PZ, JQ, LZ, HZ, BZ, XQ, ZX and DC evaluated the patients and genotyped ... Replication of the association of the aspartic acid repeat polymorphism in the asporin gene with knee-osteoarthritis susceptibility in Han Chinese J Hum Genet 2006, 51:1068-1072 24 Valdes AM, Loughlin J,...

Ngày tải lên: 12/08/2014, 15:22

... between the levels of these soluble receptors indicates that their production and/ or release are closely linked The T676G polymorphism in exon of the TNF-RII gene occurs within the fourth cysteine-rich ... various inflammatory factors may influence the release of TNF receptors, our data indicate that genetic regulation involving the TNF-RII gene may play some role in determining circulating levels in ... converting enzyme (TACE) [14] They retain their ligand binding capacity after cleavage [11,13] and can act as natural inhibitors of TNF-α by sequestering soluble TNF-α and preventing it from binding...

Ngày tải lên: 09/08/2014, 07:20

... confirm previous findings indicating that 5-HT is more relevant in the maintenance of the vascular phenomena that underlie the pathogenesis of SSc, rather than in determining their onset [38] ... mutation and other genetic variants of the 5-HT2A gene or other serotonin receptors, such as the 5-HT3A gene that was also found to play a role in the fibrotic process of SSc [40,41] Finally, the ... between the C+1354T SNP of the 5-HTR2A gene and SSc, and we then further clarified its functional role by evaluating platelet aggregation in response to the costimulation with ADP and 5-HT [14] in...

Ngày tải lên: 09/08/2014, 13:21

... on the length of the CAG trinucleotide (nt) repeat and relative expression of the HD gene We then determined the structure of the mouse CB1 gene and determined that transcription of the CB1 gene ... throughout the brain tissue in R6/1 compared to R6/2 mice [29,30] The differences between the two transgenic lines of HD mice include the length of the CAG repeat within the HD transgene and the site ... huntingtin protein are lower in the R6/1 mice compared to R6/2 [10] and that neuronal intranuclear inclusions (NIIs) containing the human transgene-encoded amino terminus of human huntingtin form...

Ngày tải lên: 16/03/2014, 18:20

... Brinkmann, A.O & Trapman, J (1997) Functional in vivo interaction between the amino-terminal, transactivation domain and the ligand binding domain of the androgen receptor Biochemistry 36, 1052–1064 19 ... subdomain AR3)13 in N/C interaction and the role of individual amino acid residues in and flanking the 23 FQNLF27motif in AR16)36 in N/C interaction Yeast protein interaction assays indicated that AR3)13 ... details Amino acid residues flanking F23, L26 and F27 modulate androgen receptor N/C interaction To study in more detail the role of 24/25QN in the 23 FQNLF27 motif in AR N/C interaction, these amino...

Ngày tải lên: 17/03/2014, 10:20

... requires further investigation The increase in BAFF level in pSS might be under the control of environmental factors Interestingly, BAFF gene expression was reported to be interferon inducible in target ... protein and BAFF mRNA levels Saturation of BAFF receptors and/ or a downregulation of their expression in patients with increased BAFF levels might further amplify the increase in BAFF protein levels ... role played by interferons in BAFF over-expression in pSS deserves further investigation Finally, our study clearly demonstrates that BAFF gene polymorphism is neither involved in genetic predisposition...

Ngày tải lên: 09/08/2014, 07:20

... aspartic acid repeat polymorphism in asporin inhibits chondrogenesis and increases susceptibility to osteoarthritis Nat Genet 2005, 37: 138-144 Mustafa Z, Dowling B, Chapman K, Sinsheimer JS, ... Caucasians, there was no evidence for an important effect of the asporin D repeat polymorphism; this was similar to the conclusion of the authors of the UK study [3] Our conclusion was based in the analysis ... However, this analysis includes the result used as reference, the Japanese study, in the subject of the comparison The correct probability is 1/8 = 0.125 Regarding the comment on the power of our study,...

Ngày tải lên: 09/08/2014, 08:22

... coincide with any critical binding sites It is most likely that the shift affects the three-dimensional structure of the protein, impairing the binding capabilities to the other proteins in the ... the result of a single SNP in Ncf1, resulting in the shift from threonine to the disease-promoting methionine at position 153 in the p47phox protein [21] The consequences of the amino acid shift ... causing the haplotype association Homozygosity could explain the genetic risk associated with rs729749 The rs726749 SNP is noncoding and located in the beginning of intron in NCF4 Analysis of the...

Ngày tải lên: 09/08/2014, 10:21

... occurred in the terminal web of the epithelial cell and in the lateral junctions of the cells The localization of CSF1R in actin-rich areas of the cell is not surprising in view of data from in vitro ... polymorphisms or deletions in the CSF1R gene [25-27] There is a paucity of literature regarding the expression of the CSF1R protein in the intestine despite documentation of its presence in the ... of staining, it is tempting to hypothesize that the CSF1R protein plays a role in differentiation of intestinal epithelial cells as it does in macrophages The most intense cytoplasmic staining...

Ngày tải lên: 11/08/2014, 10:23

... homocysteine in the mechanisms associated with increased incidence of CV events in the general population, functional polymorphisms in the MTHFR gene have been proposed as potential candidates for atherosclerosis ... lack of power Finally, replication of our findings in an independent dataset is needed to confirm the implication of the MTHFR A1298C gene polymorphism in the increased risk of atherosclerosis ... Competing interests The authors declare that they have no competing interests Authors' contributions RP-M carried out genotyping, participated in the design of the study and in data analysis, and...

Ngày tải lên: 12/08/2014, 12:20

... that the Th2 cytokine IL-4 and its receptor may be of particular interest in the control of Th17-induced inflammation In mice, the genetic absence of IL-4 leads to more severe arthritis in the ... to the treatment of RA In this study, we have examined the role of a single nucleotide polymorphism in the IL-4R in the control of IL-17 production The results indicate that a polymorphism in ... UH: Inhibition of hormone and cytokine-stimulated osteoclastogenesis and bone resorption by interleukin-4 and interleukin13 is associated with increased osteoprotegerin and decreased RANKL and...

Ngày tải lên: 12/08/2014, 15:22

... collection, ELISA and DNA analysis, statistical analysis, and drafting of the manuscript FD and VC participated in the ADMA analysis DK participated in the design of the study and drafting of the manuscript ... rich in genes involved in immune and inflammatory responses It has been hypothesised that this location and wide expression in immune cells make it a candidate as a disease susceptibility gene in ... component in the phagocytic response to bacterial infection Interferon-γ, released in response to an infective insult, acts on macrophages to increase the expression of iNOS [9] This activates the...

Ngày tải lên: 13/08/2014, 03:20

... from the beginning of intron and the novel microsatellite, which included a tandem repeat of (TC)n is located approximately at 1264 bp from the beginning of intron 3.3 Allele frequencies in different ... the pig CA3 gene in Yorkshire, Landrace and Meishan breeds, microsatellite SJ160 was identified in intron 5, and microsatellite SJ158 and a novel microsatellite marker that includes a tandem repeat ... covering the entire coding region of porcine CA3 was amplified using six gene- specific primer pairs (Tab I) and compared with the cDNA sequence to clarify the exon/intron organisation The porcine...

Ngày tải lên: 14/08/2014, 13:22

... 1.7.2 The Androgen Response Elements and other Motifs in ARBS Like other DNA binding transcription factors, the AR DNA binding domain is mainly responsible for determining its DNA binding specificity ... distinct functional domains, namely, a N-terminal domain (NTD) containing transcriptional activation units (AF-1 and AF-5), a DNA binding domain (DBD) where four-cysteine zinc-binding domains ... 53 3.2 Binding Kinetic Analysis of AR and ERG to the Chromatin post Androgen Stimulation 56 3.3 Generation of the AR and ERG Cistromes using ChIP-Seq 59 3.4 Binding Kinetic Cistromic...

Ngày tải lên: 09/09/2015, 10:14

... ABPs in transcription regulation B Zheng et al Table Role of nuclear actin-binding proteins interacting with the androgen receptor AR, androgen receptor; LBD, ligand-binding domain Actin-binding ... central DNA-binding domain (DBD) and a C-terminal ligandbinding domain (LBD) containing activation function [67–70] Upon binding androgens, the AR LBD undergoes conformational changes leading to dissociation ... Bundling proteins Coactivator Supervillin NLS F-actin- and membraneassociated scaffolding protein Filamin NLS? Cross-linking proteins Filamin A NLS? Cross-linking proteins Transgelin ()) Cross-linking...

Ngày tải lên: 07/03/2014, 01:20

... of MREs in the promoter of the WD gene suggests that MREs and their cognate binding proteins function in the regulation of WD gene expression Because the T1 and C3 nucleotides within the MRE ... another band of 82 kDa when the MREa-protein band from the EMSA was excised from the native gel and resolved by SDS/PAGE (unpublished data) We purified the MREa-binding proteins using the avidin–biotin ... WD gene are indicated in Fig The four MREs are located in the proximal region of the WD gene promoter between )434 and +114, with MREa and MREe in the forward orientation, and MREc and MREd in...

Ngày tải lên: 17/03/2014, 23:20