cabbages cauliflowers kohlrabi kale and similar edible brassicas fresh or chilled

... have gone to the park than stay home I used to visit my grandparents every weekend Shall I open the door? I shall arrive at nine (will is more common) Exercises 1.He …….leave early, didn’t he? (must/ ... (shouldn’t/hadn’t to/ couldn’t/ can’t) there’s the waiter I …… ask him for the bill (will/ shall/ am able to/ could) ………….open the door for you? (Would you like that I / Do you want that I /will I / shall) ... advantage of this opportunity to thank for your co-operation (would like/can/ am able to/ might) 15 you ………… add it up I’m not good at figures.(a.have to/b ought to/c ‘d better/ both b and c) 16 the...

Ngày tải lên: 14/09/2013, 01:10

... GAATTCACCATTATGAGCACTTTTA) and PCR_AmiA_EcoRI_rev (GGCCGAATTCGCTGTGTCCGTTGCTG GTT) for AmiA, and PCR_MdoD_EcoRI_for (GGCCGA ATTCACCATTATGGATCGTAGAC) and PCR_MdoD_EcoRI rev (GGCCCAATTCGTCAAAACGCTGGGTT TGC) for MdoD ... substrates (90 kDa), and is required for anaerobic growth on minimal trimethylamine N-oxide (TMAO) and glycerol media Well-established export assays have been described for TorA transport and we have ... Council for Earth and Life Sciences of the Netherlands Organization for Scientific Research References Cline K, Ettinger WF & Theg SM (1992) Protein-specific energy requirements for protein transport...

Ngày tải lên: 16/03/2014, 04:20

... proposition Similarly, Conj(x) and Subord(x) perform more specific tests for complex propositions: coordination or subordination, respectively Moreover, P red1 (x, x1 ) accesses the first proposition and ... Europarl corpora and a corpus of tutorial dialogs on mathematics (Wolska et al., 2004) We also performed several internet searches We looked at the German phrases andersrum and umgekehrt, and their ... languages” and “geographical separation” – yields the desired result gorize underlying interpretation patterns, describe the reconstruction algorithm, and evaluate it Data Collected From Corpora In order...

Ngày tải lên: 31/03/2014, 01:20

... responsible for formulating for their own organisation the policy framework within which their tactical commanders will work, prioritising organisation demands as a whole Where more that one organisation ... safety information to contractors on site; n monitoring and co-ordinating safety performance; n co-ordinating safety in response to a major incident 66 To be effective, the safety co-ordinator needs ... Safety co-ordinators can assist in the: n selection and monitoring of contractors; n liaison with contractors, self-employed people on site and the health and safety enforcement authority; n checking...

Ngày tải lên: 01/07/2014, 16:53

... Judith and Hamlet, were born February 2, 1585 It is not known for sure how he supported his family or where they lived but the early 1590’s, he was established in London as both an actor and playwright ... young men and woman, their friendship and love, their search for happiness They are filled with humanist love for people and their belief in the nobleness and kindness of human nature Historical ... London and returned to his native town of Stratfordupon- Avon Three year later, on April 23, 1616, he died and was buried there Shakespeare is the author of poems, 37 plays and 154 sonnets His works...

Ngày tải lên: 22/08/2013, 15:48

... Settlements or the Bank of Thailand Borio: Monetary and Economic Department, Bank for International Settlements, claudio.borio@bis.org; Disyatat: Monetary Policy Group, Bank of Thailand, pitid@bot .or. th ... expenditures and production may be underpinned by substantial borrowing and lending (eg to pay for factors of production in advance of sales or loans for consumption) Disyatat (2010a), for instance, ... Fiore, F and O Tristani (2008): “Credit and the natural rate of interest,” ECB Working Paper, no 889 Despres, E, C P Kindleberger and W S Salant (1966): The dollar and world liquidity: a minority...

Ngày tải lên: 17/02/2014, 03:20

... young men and woman, their friendship and love, their search for happiness They are filled with humanist love for people and their belief in the nobleness and kindness of human nature Historical ... known for certain that at age 18, he marries Anne Hathaway with whom he had children Susanna was born May 26, 1583 and the twins, Judith and Hamlet, were born February 2, 1585 It is not known for ... Responsibility and doom We have seen that Romeo and Juliet's decisions and actions play an important role in the play It is them who manage to start a relationship, it is Romeo who kills Tybalt and therefore...

Ngày tải lên: 19/02/2014, 09:49

... forms (for example, tablets, sticks or similar forms) for use as fuels, or liquid or liquefied-gas fuels in containers of a kind used for filling or refilling cigarette or similar lighters and ... function or functions here listed 8.- For the purposes of 2937: (a) “hormones” includes hormone-releasing or hormone-stimulating factors, hormone inhibitors and hormone antagonists (anti-hormones); ... agents or as luminophores (3204) or dyes or other colouring matter put up in forms or packings for retail sale (3212); (g) Enzymes (3507); (h) Metaldehyde, hexamethylenetetramine or similar substances,...

Ngày tải lên: 28/03/2014, 20:20

... Bonaparte, by false representations and promises of pecuniary support, to undertake to restore things to their former state; and the result is before the world as an example and a warning When will our ... of Indian corn; flocks and herds are every where fat in the fields; and the liberty and equality doctrine, nonsensical and wicked as it is, (in this land of tyrants and slaves,) is for electioneering ... is one and uniform, and too explicit to be misunderstood It assures us, and writes the assurance in lines of blood, that the way of the transgressor is hard, and that though hand join in hand,...

Ngày tải lên: 31/03/2014, 11:20

... another For example, while an editor worries about providing fresh, useful, and thorough information, a publisher worries about paying the printing bills and affording the rising cost of paper Or it ... world, there is a finite amount of money available for starting publications In recent years, start-up capital has become more and more concentrated in fewer hands, both for magazines and for ... newsletters and magazines, sometimes fortunes worth I cofounded three magazines that turned out to be world-class moneymakers: PC magazine, PC World, and Macworld All three were quickly profitable and...

Ngày tải lên: 18/04/2014, 14:10

... another For example, while an editor worries about providing fresh, useful, and thorough information, a publisher worries about paying the printing bills and affording the rising cost of paper Or it ... world, there is a finite amount of money available for starting publications In recent years, start-up capital has become more and more concentrated in fewer hands, both for magazines and for ... newsletters and magazines, sometimes fortunes worth I cofounded three magazines that turned out to be world-class moneymakers: PC magazine, PC World, and Macworld All three were quickly profitable and...

Ngày tải lên: 18/04/2014, 14:14

... collaboration and information, and problem team effort required methods, for this project - solving bringing together CTU, HAU and SOFRI personnel it has been extremely useful and incorporated ... equiping postharvest laboratories for teaching and research have become priorities for nearly all institutions and communication has allowed for active exchange of information The relationship ... Outputs and Performance indicators Outputs Performance Indicators Curriculum and teaching i resource material for use in Universities: distance learning booklets and resource material ii for rural...

Ngày tải lên: 22/06/2014, 13:20

... toxicity tests and the incorporation of professional judgment in the form of correction factors add uncertainties (and sometimes controversy) to water quality standards Among the standardized tests, ... control nanoreleases This is unfortunate, because at present there are major technical obstacles to using these acts Practical methods for monitoring nanosilver in air and water and methods for controlling ... considered For silver, this greatly affects determination of concentrations that are toxic (see later discussion) Correction factors, or application factors, are incorporated into regulatory criteria...

Ngày tải lên: 27/06/2014, 21:20

... twenty or more He has black hair, a broad forehead, a straight nose and bright eyes He is very good-looking He has a kind heart and is easy to get on with everybody We have been friends for a very ... up early in the morning to have enough time to deliver newspapers to subscribers before going to school After school in the afternoon, he repairs bicycles and motorbikes Therefore the money he ... he gets from his manual job is sufficient for his school fees and for his parents’ presents I like Nam very much because of his honesty and straight forwardness He is always ready to help his...

Ngày tải lên: 22/07/2014, 04:20

... scale is a nine-organ disease severity scale in which for each organ system a score of to is applied, with being normal and denoting end-stage organ involvement [19] We also recorded statin use, ... cardiovascular morbidity and mortality in the aforementioned autoimmune diseases, attention has been given to the presence and treatment of cardiovascular risk factors Despite increased mortality rates ... models, corrections were made for the confounders high-density lipoprotein (HDL) cholesterol, and gender or cage, HDL cholesterol, and history of macrovascular disease; a total of 66 patients and...

Ngày tải lên: 09/08/2014, 10:23

... structural and/ or regulatory genes responsible for the synthesis and expression of cr-amylase In the work by Doane [4], a clear absence of dependence was found between the total amylase activity and ... method described by Noelting and Bernfeld [11] Midgut dissection and aamylase activity pattern were performed according to Abraham and Doane [1] The results were analysed for each line of Drosophila ... regions and the specific activity of the enzyme, as parameters, were analysed within and between the Amy and Amy genotypes Line grouping s F was performed according to deviations outside ± standard...

Ngày tải lên: 09/08/2014, 18:21

... ChIP and input samples from the two datasets Integrative analysis of ChIP-chip data Probe behavior model estimate and probe standardization for individual tiling array platforms For the one-color ... the MAT and MA2C scores are approximately normally distributed, Z-scores were calculated based on the null distribution of MAT/MA2C scores to normalize the scores from different platforms The ... similar way to the MAT and MA2C algorithms: for a given Z-score cutoff value Z0 (Z0 > 0) that corresponds to the user-specified P-value, MMChIP finds all peaks with Z-scores greater than Z0 and...

Ngày tải lên: 09/08/2014, 22:23

... design and coordination and revised the manuscript All authors read and approved the manuscript Page of Competing interests Roel Goldschmeding has been employed by and received research support ... between the CC, CG and GG genotypes in terms of mortality or development of ESRD in the total population under study (Table 3) Also, in separate analyses of normoalbuminuric patients and patients with ... the genotyping assay and helped revise the manuscript DL validated the CTGF ELISA assay HHP, LT and PR set-up the patient database and provided DNA and plasma samples, PR and LT also helped revise...

Ngày tải lên: 11/08/2014, 07:21

... to report both measures for interval scale level data and measures for ordinal scale level data As measures of congruency for interval scale level data intraclass correlations (ICC) according ... and CGI-I Means and standard deviations (SD) for CGI-Sadm, CGIS dis and for CGI-I were calculated Corrected effect sizes d were calculated between CGI-Sadm and CGI-S dis Forkmann et al BMC Psychiatry ... indication-irrelevant adverse events reported by the patient Participants were asked to rate the severity of a major depressive disorder or a generalized anxiety disorder and nausea or dizziness served as indication...

Ngày tải lên: 11/08/2014, 15:22

... basic arguments for and against mandatory auditor rotation appear in numerous reports and articles Briefly, the basic argument for mandatory rotation is that it provides a fresh look’ at a client’s ... SHORT and LONG variables For SHORT tenure, we use cut-offs of four and five years and for LONG tenure, we use cut-offs of 8, 10, 20 and 25 years in place of the previous fifteen years or more ... Effects of Mandatory Audit Firm Rotation Gow, I., G Ormazabal and D Taylor 2008 Correcting for cross-sectional and time-series dependence in Accounting research Working paper Stanford University...

Ngày tải lên: 06/01/2015, 19:42