ca2 result in a progressive inhibition of reverse bend growth and can lead to
Báo cáo y học: " Intragenic transcriptional cis-activation of the human immunodeficiency virus 1 does not result in allele-specific inhibition of the endogenous gene" pdf
Ngày tải lên :
13/08/2014, 05:21
... AxGTCGACCTGCAGACAxGGGTGATCCTCAxGTTTTCTAGGCAATxA AxAGTTTCCAGAAxTCCACACCGGAGACCCCACxTCCAGGATTCAAACCxT CxCAGCGTCCGCxCACTTCCTCCCCAAAACCCCxCCAAAAAAATTGTTxT AxGGTTGGTATAAACACAxAAAGCATGGTGGTxGTCTGGAGCTGGGGTTxA AxTGCAGTGAGCCATGAxCACACCACAGTACxACAGCCTGGGTGATGAAxA ... AxTGCAGTGAGCCATGAxCACACCACAGTACxACAGCCTGGGTGATGAAxA AxATTGCTGTCCTAAxCAGACTGCACCTGTGGxGTGGCTCTGACTGGTxA AxGGTATGGTGGCAAAxCGACTCCCCCAGxACAACCACCAGAATATCAGxA AxACGCCGAAGTCGCxGAAGCAGATCTATCTGCxCTATGGTAAATCTGGxA AxATAACTGTTGCTAGGxGACGGGGACATTCCCGAAxGCTGCGTCTGTxA ... HMBOX_E 3a GGCGAGCCCTCAGATCCTGC GGGTCTCTCTGGTTAGACCAGATCTGAGCC AGTCGCCGCCCCTCGCCTCCTGC GGATTAACTGCGAATCGTTCTAGC CGTCTGTTGTGTGACTCTGGTAACT GTCTCTTTCCTCACTTCTTTCT TCACAGTTTCCAGAACTCCAC GGAATGGAACAGTGAAGAAGCA...
- 15
- 329
- 0
A comparative analysis of institutions, national policies, and cooperative responses to floods in Asia
Ngày tải lên :
22/10/2013, 10:15
... debris in mountain areas, while in deltas and wetland areas they can prevent and alter natural drainage, thus increasing the duration and height of floods During post-disaster periods there is often ... and explaining success and failures in their performance and in behavior of main stakeholders Analysis of major lessons learned about coping capacities/incapacities of the countries during catastrophic ... River basin in addition to modernization of local infrastructure to reduce flood damage and to change the crop patterns, plans are underway to take advantage of flooding by expanding aquatic production...
- 39
- 534
- 0
báo cáo hóa học: " Selective COX-2 inhibition prevents progressive dopamine neuron degeneration in a rat model of Parkinson''''s disease" potx
Ngày tải lên :
19/06/2014, 22:20
... estimation of total numbers was performed using the Microbrightfield software and cell density was calculated for striatal and midbrain volumes The striatum was outlined according to anatomical landmarks ... response 12 (top panel) and 21 (bottom tracersdays measured6-OHDA lesion of dopamine terminal loss and inflammaA) Using A) Using micro-PET and selective radioactive tracers we measured in vivo the ... the 2nd and 3rd week after DA terminal injury by 6-OHDA, our data indicate that nigro-striatal DA terminals were restored in striatum, and a significant population of DA neurons where spared from...
- 11
- 450
- 0
Báo cáo sinh học: "Gene therapy with tumor-specific promoter mediated suicide gene plus IL-12 gene enhanced tumor inhibition and prolonged host survival in a murine model of Lewis lung carcinoma" pptx
Ngày tải lên :
18/06/2014, 19:20
... CA, USA) according to the manufacturer’s instructions Immunohistochemical analysis and apoptosis assay Tumor tissues were formalin fixed and μm sections were stained with hematoxylin and eosin ... the National Natural Science Foundation of China (No 30672438) and the Hubei Provincial Natural Science Foundation of China (Nos 2006ABC009 and JX 4A0 6) Author details Department of Radiation and ... SEM) was determined In vivo toxicity studies Sera were collected from the treated animals to measure the biochemistry markers including alanine transaminase (ALT), aspartate aminotransferase (AST),...
- 10
- 696
- 0
báo cáo hóa học: " Tumor necrosis factor-mediated inhibition of interleukin-18 in the brain: a clinical and experimental study in head-injured patients and in a murine model of closed head injury." pot
Ngày tải lên :
19/06/2014, 22:20
... Dinarello CA, Novick D, Rubinstein M, Otto VI, Rancan M, Kossmann T, Redaelli CA, Trentz O, Shohami E, Stahel PF: Elevated intracranial IL-18 in humans and mice after traumatic brain injury and ... 4°C Thereafter, the supernatants were aliquoted and stored at -70°C until analysis The concentrations of total protein in the brain extracts were measured by Bradford assay (Bio Rad Laboratories, ... time-point, compared to WT littermates, implying that at later time-points the lack of TNF leads to adverse outcome after brain injury [31] Barger and colleagues have previously shown in an in vitro...
- 6
- 436
- 0
báo cáo hóa học: " Inhibition of NF-κB activation by 5-lipoxygenase inhibitors protects brain against injury in a rat model of focal cerebral ischemia" docx
Ngày tải lên :
19/06/2014, 22:20
... Justicia C, Camins A, Planas AM: Activation of nuclear factor-kappaB in the rat brain after transient focal ischemia Brain Res Mol Brain Res 1999, 65:61-69 Zhang W, Potrovita I, Tarabin V, Herrmann ... Schwaninger M: NF-kappaB is activated and promotes cell death in focal cerebral ischemia Nat Med 1999, 5:554-559 Rothwarf DM, Karin M: The NF-kappa B activation pathway: a paradigm in information ... score (ranging from to as detailed in Methods) Data are expressed as mean ± SD for infarct area and infarct volume and as range and median for neurological deficit score *p < 0.001 vs vehicle inhibition...
- 13
- 474
- 0
báo cáo hóa học:" Gene therapy with tumor-specific promoter mediated suicide gene plus IL-12 gene enhanced tumor inhibition and prolonged host survival in a murine model of Lewis lung carcinoma" doc
Ngày tải lên :
20/06/2014, 03:20
... CA, USA) according to the manufacturer’s instructions Immunohistochemical analysis and apoptosis assay Tumor tissues were formalin fixed and μm sections were stained with hematoxylin and eosin ... the National Natural Science Foundation of China (No 30672438) and the Hubei Provincial Natural Science Foundation of China (Nos 2006ABC009 and JX 4A0 6) Author details Department of Radiation and ... SEM) was determined In vivo toxicity studies Sera were collected from the treated animals to measure the biochemistry markers including alanine transaminase (ALT), aspartate aminotransferase (AST),...
- 10
- 485
- 0
Báo cáo y học: "Intrathecal siRNA against Toll-like receptor 4 reduces nociception in a rat model of neuropathic pain"
Ngày tải lên :
25/10/2012, 11:48
... plasticity and inflammatory responses (38-39) Accumulating evidence shows that all three MAPK pathways contribute to pain sensitization after inflammatory and nerve injury via distinct molecular and ... p38 MAPK, and stress-activated protein kinase/c-Jun N-terminal kinase (SAPK/JNK) (37) MAPKs are important for intracellular signal transduction and play critical roles in regulating neural plasticity ... protein kinase (MAPK) transduction cascades (36) The NF-kB cascade leads to release pro-inflammatory cytokines (IL-6, IL-1β, TNF-α) The MAPK kinases activate extracellular signal-regulated kinase...
- 9
- 487
- 0
Tài liệu Psychometric properties of the quality of life scale Child Health and Illness Profile-Child Edition in a combined analysis of five atomoxetine trials pdf
Ngày tải lên :
12/02/2014, 19:20
... domains and between the domains and the total score at baseline, at endpoint after the placebo-controlled period, and for the change from baseline to that endpoint Sub-domains At baseline At ... 340 Table Cronbach’s alpha (standardized) for the subdomains and the lowest alpha that was reached by deleting an item in that sub-domain with 95% CIs A Schacht et al Sub-domains At baseline At ... Pediatrics 108:e83–e91 Montoya A, Hervas A, Cardo E, Artigas J, Mardomingo MJ, Alda JA, ´ Gastaminza X, Garc a- Polavieja MJ, Gilaberte I, Escobar R (2009) Randomized controlled trial of atomoxetine...
- 15
- 1.2K
- 0
Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx
Ngày tải lên :
15/02/2014, 01:20
... eukaryotic initiation factor 5A (eIF 5A) , parathymosin, L7 ⁄ L12, annexin A2 , annexin A5 , aldolase A, fascin and peroxyredoxin 1] displayed quantitative differences, regardless of whether or not a- synuclein ... Sequence coverage (%) Fb Pb Observed change RPLP2 Parathymosin eIF 5A isoform B L7 ⁄ L12, mitochondrial Peroxiredoxin Annexin A5 Annexin A2 Aldolase A Fascin Pyruvate kinase VDAC-2 Stathmin Ran1BP GSTp ... Complex Change in pattern Change in pattern a Theoretical values b F and P refer to ANOVA c Identified from SWISS 2D-PAGE database dehydrogenase and to mitochondrial ATP synthase a subunit by comparison...
- 11
- 775
- 0
Tài liệu A spoonful of progress in a bowl full of unhealthy marketing to children docx
Ngày tải lên :
18/02/2014, 02:20
... one-half of ads seen by adults contain this level of sugar 700 TV ads viewed per year ■ Children's annual exposure to cereal ads on TV* ■ Adult brands and company ads ■ Family brands ■ Child brands ... Beverage Advertising Initiative in action Available at www.bbb.org/us/ childrens-food -and- beverage-advertising-initiative/ Children’s Food & Beverage Advertising Initiative (April 2012) Food and ... and adult cereals (marketed to adults for their own consumption) We also used syndicated market research data and independent analyses to quantify young people’s exposure to marketing on TV and...
- 4
- 397
- 0
Tài liệu Báo cáo khoa học: Destabilization of psychrotrophic RNase HI in a localized fashion as revealed by mutational and X-ray crystallographic analyses pdf
Ngày tải lên :
18/02/2014, 13:20
... (A) No of molecules No of protein atoms No of water molecules R-factor (%) Rfree (%)b rmsd ˚ Bond length (A) Bond angles (deg) ˚ Mean B factors (A2 ) Main chain Side-chain Ramachandran plot statistics ... extension: tailor-made genes using the polymerase chain reaction Biotechniques 8, 528–535 34 Kanaya S, Katsuda C, Kimura S, Nakai T, Kitakuni E, Nakamura H, Katayanagi K, Morikawa K & Ikehara M (1991) ... Displacement of the Ca coordinates between the 6·-RNase HI and wild-type proteins (full line) and between molecules C and D (broken line) a Helices and b strands are indicated by bars helices, and...
- 11
- 648
- 0
Tài liệu Báo cáo khoa học: "Identifying Linguistic Structure in a Quantitative Analysis of Dialect Pronunciation" docx
Ngày tải lên :
20/02/2014, 12:20
... in the word ’Washington’ or the second vowel in the word ’thirty’ Factor analysis has shown that factors are most important, explaining 35% of the total amount of variance The main drawback of ... statistical data analysis based on a partition of a set of objects into groups or clusters (Manning and Schütze, 1999) Multidimensional scaling is data analysis technique that provides a spatial ... Bulgaria Stojko Stojkov 1966 Atlas of Bulgarian Dialects: Northeastern Bulgaria Publishing House of Bulgarian Academy of Science, volume II, So a, Bulgaria Stojko Stojkov 2002 Bulgarska dialektologiya...
- 6
- 651
- 0
Báo cáo khoa học: "Searching for Topics in a Large Collection of Texts" doc
Ngày tải lên :
08/03/2014, 04:22
... Proceedings of the International Symposium on Information and Communication Technologies, pages 311–316 Trinity College Dublin, Ireland JAMA 2004 JAMA: A Java Matrix Package Publicdomain, http://math.nist.gov/javanumerics/jama/ ... -parameters are used, the Local Search procedure tries to simulate the behavior of human annotator who finds topically coherent clusters in a training collection The task of -optimization leads ... morphologically analyzed and lemmatized (Hajiˇ , 2000) and then indexed and repc resented as a vector We indexed only lemmas of nouns, adjectives, verbs, adverbs and numerals whose document frequency was...
- 6
- 447
- 0
Bell & Howell Information and Learning 300 North Zeeb Road, Ann Arbor, MI 48106-1346 USA 800-521-0600UMI.The Potential of Soil Survey Data in a Quantitative Evaluation of Surficial Geology Mapping in Northern Maine by Rosalia EvansThesis submitted t pptx
Ngày tải lên :
08/03/2014, 23:20
... fine sandy loam Madawaska fine sandy loam Madawaska fine sandy loam Made land Mapleton shaly silt loam Mapleton shaly silt loam Mapleton shaly silt loam Mixed alluvial land Monarda and Burnham silt ... Howland gravelly loam Howland gravelly loam Howland gravelly loam Howland very stony loam Howland very stony loam Machias gravelly loam Machias gravelly loam Machias gravelly loam Madawaska fine ... terraces, 1on a kame, and on a kame terrace Glaciolacustrine originating as a blanket formation and a deltaic formation Colluvium originating on a kame terrace Organic swamp originating as a blanket...
- 131
- 599
- 0
Báo cáo khoa học: E2A participates in a fine control of pre-mature B-cell apoptosis mediated by B-cell receptor signaling via transcriptional regulation of survivin, IAP2 and caspase-8 genes pot
Ngày tải lên :
16/03/2014, 04:20
... cell-specific factors, HDACs, HATs, apoptosis-related factors, caspases, caspase-regulating factors and CAD/ICAD) mediated by PMA/ionomycin results in suppression of activities of caspase-3, caspase-8 and ... factors, caspases, caspase-regulating factors and CAD/ICAD led to changes in the activities of caspase-3, caspase-8 and caspase-9, and in the protein levels of IAP2 and ICAD (Fig 4A, B), consistent ... showed that GCN5 and BCR signaling collaborate to induce apoptotic cell death of the DT40 cell line, through depletion of ICAD [inhibitor of caspase-activated DNase (CAD)] and inhibitor of apoptosis...
- 11
- 349
- 0
SCIENTIFIC DEVELOPMENTS AND TECHNICAL CHALLENGES IN THE PROGRESSIVE CONTROL OF FMD IN SOUTH ASIA pot
Ngày tải lên :
18/03/2014, 00:20
... characteristics in relation to circulating virus strains, vaccine coverage, age of vaccinates, maintenance of the cold chain during vaccine shipping and application, and training of vaccinators ... ml for A annually Large-scale animal farms have to be carried out vaccination strictly according to vaccination rules Two vaccination campaigns have been applied for backyardfarming animals respectively ... due to vaccination, measured in individuals in the field It combines issues such as vaccine quality, duration of protection and correct application of the vaccine Farm managers in Kenya maintain...
- 81
- 635
- 1
Gender inequality in health among elderly people in a combined framework of socioeconomic position, family characteristics and social support doc
Ngày tải lên :
22/03/2014, 14:20
... Silvia Rueda and Luc a Artazcoz Ferraro, K and Famer, M 1996 Double jeopardy Aging as leveler, or persistant health inequality ? A longitudinal analysis of white and black Americans Journal of ... position was measured through two indicators: educational attainment and material deprivation Educational attainment was generated by collapsing some categories of the original variable because of the ... water, having central or dispersed heating, having an elevator, and having a washing machine The resulting variable, household resources, had the following three categories : not lacking any of the...
- 23
- 420
- 0
Charles Darwin: His Life in an1Charles Darwin: His Life in anAutobiographical Chapter, and in a Selected Series of His Published Letters, by Charles Darwin, Edited by Sir Francis Darwin This eBook is for the use of anyone anywhere at no cost and with potx
Ngày tải lên :
23/03/2014, 05:20
... out a separate abstract, and of such abstracts I have a large drawer full Before beginning on any subject I look to all the short indexes and make a general and classified index, and by taking ... islands of the Galapagos archipelago, and of all of them to the inhabitants of South America As far as I can judge of myself, I worked to the utmost during the voyage from the mere pleasure of investigation, ... fair laboratory with proper apparatus in the tool-house in the garden, and I was allowed to aid him as a servant in most of his experiments He made all the gases and many compounds, and I read...
- 245
- 605
- 0