c677t and a 1298c and its association with cancer risk

Báo cáo y học: "Epidemiological manifestations of hepatitis C virus genotypes and its association with potential risk factors among Libyan patients" pps

Báo cáo y học: "Epidemiological manifestations of hepatitis C virus genotypes and its association with potential risk factors among Libyan patients" pps

... epidemiological data and analyzed data statistically and helped in writing and revising the manuscript YMA; Helped in the study, analysing and revising the data BAA; Treating and following up patients, helped ... Cite this article as: Elasifer et al.: Epidemiological manifestations of hepatitis C virus genotypes and its association with potential risk factors among Libyan patients Virology Journal 2010 ... intervention and blood transfusion respectively The same is applicable for genotype While genotype and were common inpatient with IVDA Configuration of HCV subtypes and its association with the risk factors...

Ngày tải lên: 12/08/2014, 02:20

7 257 0
Báo cáo y học: "Prevalence of alexithymia and its association with anxiety and depression in a sample of Greek chronic obstructive pulmonary disease (COPD) outpatients" pptx

Báo cáo y học: "Prevalence of alexithymia and its association with anxiety and depression in a sample of Greek chronic obstructive pulmonary disease (COPD) outpatients" pptx

... draft the paper; GM and AK helped draft the paper; II carried out the statistical analysis and helped draft the paper; NS and AV supervised the study; NT carried out Page of the statistical analysis, ... K, Ohi M, Nakagawa M, Fujita M, Sato K, Shimada K, Yamaoka S, Oda Y, Asai N, Sagawa Y, Kuno K: Relationship between dyspnoea in daily life and psycho-physiologic state in patients with chronic ... COPD [15], as well the reported associations among depression, anxiety, somatic symptoms and alexithymia [27], we studied the prevalence of alexithymia and its association with anxiety and depression...

Ngày tải lên: 08/08/2014, 23:21

7 437 0
THE STUDY OF a NOVEL MIXED LINEAGE LEUKEMIA 5 ISOFORM AND ITS ASSOCIATION WITH HUMAN PAPILLOMAVIRUS 16 18   RELATED HUMAN CERVICAL CANCERS

THE STUDY OF a NOVEL MIXED LINEAGE LEUKEMIA 5 ISOFORM AND ITS ASSOCIATION WITH HUMAN PAPILLOMAVIRUS 16 18 RELATED HUMAN CERVICAL CANCERS

... Forward CCACCACAAAAGAAAAAGGTTTCTC Reverse GTGTTGGTAAAGGTAGGCTAGC MLL5β Forward GAAAACCCAGAGTGCCCTGTTCTA Reverse CAATATACGCGAGACTAGTCTT GAPDH Forward GTGAAGGTCGGAGTCAACG Reverse TGAGGTCAATGAAGGGGTC ... CGCGGATCCAATGGACTACAAAGACGATGAC GACAAGAGCATAGTGATCCCA MLL5β M5b_NotI.rev AAGGAAAAAAGCGGCCGCCAATATACGCGA GACTAGTCTT GFPMLL5β M5b_SalI.for ACGCGTCGACATGAGCATAGTGATCCCATTG M5b_BamHI.rev CGCGGATCCCAATATACGCGAGACTAGTCTT Primers ... CATCTGACATATTTTCCCGCTTCCGGCGTTGT AGTAGCAC 36    GFP- M5_Y35 8A. for AGAGGGAAGTTTATG MLL5β‐ SET mut ATTTGCCTCCTGATGCACTTATCATTGAAGCC M5_Y35 8A. rev CATAAACTTCCCTCTGGCTTCAATGATAAGTG CATCAGGAGGCAAAT...

Ngày tải lên: 02/10/2015, 17:15

140 396 0
báo cáo sinh học:" Alexithymia and its association with burnout, depression and family support among Greek nursing staff" docx

báo cáo sinh học:" Alexithymia and its association with burnout, depression and family support among Greek nursing staff" docx

... the mathematical analysis and drafted the paper; CS, AM and KG performed the clinical measurements, collected data and helped draft the manuscript; EZ carried out the mathematical analysis; II conceived ... strongly associated with alexithymia in the general population Journal of Psychosomatic Research 2000, 48:99-104 Karkanias A, Moussas G, Stamouli D, Tselebis A, Bakogianni T: Alexithymia, anxiety and ... Tselebis A, Bratis D, Moussas G, Karkanias A, Tzitzanidou G, Lekka D, Papageorgiou E, Ilias I: Study of anxiety, family support and type A behavior in patients with cardiovascular disease 27th...

Ngày tải lên: 18/06/2014, 17:20

6 451 0
báo cáo hóa học: " Biomarkers of oxidative stress and its association with the urinary reducing capacity in bus maintenance workers" pptx

báo cáo hóa học: " Biomarkers of oxidative stress and its association with the urinary reducing capacity in bus maintenance workers" pptx

... glucoronidase at 37°C for at least hours The hydrolysate was loaded on a C18 SPE cartridge, preconditioned with methanol and water After lavage with mL water and mL hexane, the analyte was eluted with ... field campaign, performed the PM measurements and characterization, evaluated and interpreted the data and participated in the writing of the manuscript AS: organized the field campaign, was responsible ... characterization of gaseous pollutants, performed the urinary 8OHdG measurements, evaluated and interpreted the data, prepared and participated in the manuscript writing PW: evaluated the data,...

Ngày tải lên: 20/06/2014, 00:20

13 483 0
báo cáo hóa học:" BMP-2 signaling in ovarian cancer and its association with poor prognosis" pot

báo cáo hóa học:" BMP-2 signaling in ovarian cancer and its association with poor prognosis" pot

... 5'-ctgagaagcaccaaacgtga; Smad6 fw 5'-gagctgagccgagagaaaga, rev 5'-agatgcacttggagcgagtt: Snail fw 5'-gagtggttcttctgcgctac, re v 5'-cagagtcccagatgagcatt; Wnt 5a fw 5'-gcgcgaagacaggcatca aag, rev 3'-ggcgttcaccacccctgctg; ... 5'-gcgctggctcacccctacct, rev 5'-gccccagggtgcagagatgtc, BMPR 1a fw 5'-cttattcagctgcctgtggt, rev 5'-attcttccacgatccctcct; BMPR1b fw 5'tacaagcctgccataagtgaagaagc, rev 5'-tcatcgtgaaacaatatccgtctg and BMPR2: ... and DMP Collection and analysis of molecular data: CLP, MP, MZ and LM Collection and Assembly of data: CLP Data analysis and interpretation: CLP, MdeL, MZ and LM Manuscript writing: CLP and AMMM...

Ngày tải lên: 20/06/2014, 07:20

11 406 0
Báo cáo y học: " Mitochondrial targeting of human NADH dehydrogenase (ubiquinone) flavoprotein 2 (NDUFV2) and its association with early-onset hypertrophic cardiomyopathy and encephalopathy" ppt

Báo cáo y học: " Mitochondrial targeting of human NADH dehydrogenase (ubiquinone) flavoprotein 2 (NDUFV2) and its association with early-onset hypertrophic cardiomyopathy and encephalopathy" ppt

... were detected by an anti-c-myc antibody b-tubulin was used as a cytosolic marker and ATP synthase subunit a (ATP a) was used as a mitochondrial marker Liu et al Journal of Biomedical Science 2011, ... mitochondrial targeting of this protein, but maintaining a net positive charge and an amphiphilic structure with the overall balance and distribution of basic and hydrophobic amino acids is important ... 0.95 Pathogenic mutations found to affect protein localization are called mislocalization mutations Modification in mitochondrial targeting signals can cause a protein not arriving at its final...

Ngày tải lên: 10/08/2014, 05:21

17 434 0
Báo cáo y học: "Psychological quality of life and its association with academic employability skills among newlyregistered students from three European faculties" ppt

Báo cáo y học: "Psychological quality of life and its association with academic employability skills among newlyregistered students from three European faculties" ppt

... to assess the QoLpsychological and to analyse its association with academic employability skills (AES), and other relevant factors among students at three European faculties: the Faculty of Language ... general/academically orientated training Social status of parents defined by educational level and occupation did not play a role in this association However, the academic employability skills and ... taking vocational/professional courses in Luxembourg and Romania We found that this association could vary across faculties as it was negative among their general/ academically oriented Belgian counterparts...

Ngày tải lên: 11/08/2014, 15:22

10 432 0
Báo cáo y học: "Prevalence of endotoxemia after surgery and its association with ICU length of stay" potx

Báo cáo y học: "Prevalence of endotoxemia after surgery and its association with ICU length of stay" potx

... of stay (LOS) are presented as median and interquartile ranges Other data are presented as mean ± standard deviation APACHE = Acute Physiology and Chronic Health Evaluation; EA = endotoxin activity ... dialysis On admission and the next morning, clinical history and laboratory data were taken Cardio-respiratory variables were recorded and Acute Physiology and Chronic Health Evaluation (APACHE) ... postural changes, blood loss, and vasoplegia all cause relative or absolute hypoperfusion that may favor bacterial translocation Buttenschoen and colleagues have in fact shown that major abdominal...

Ngày tải lên: 13/08/2014, 16:21

8 298 0
Báo cáo y học: "Walking for leisure among adults from three Brazilian cities and its association with perceived environment attributes and personal factors" pot

Báo cáo y học: "Walking for leisure among adults from three Brazilian cities and its association with perceived environment attributes and personal factors" pot

... Isabela Ribeiro: isa.ribeirolucas@gmail.com Diana C Parra: dparra@gwbmail.wustl.edu Adriano A F Hino: manaca@yahoo.com.br Pedro C Hallal: prchallal@gmail.com Deborah C Malta: deborah.malta@saude.gov.br ... educational status and better perceived health in all cities and with lack of nearby sidewalks in the city of Vitória and in the combined data No associations were found with sex, marital status, ... low air quality and lack of parks, sidewalks and sports and recreation facilities Changes in the environment can encourage people to be more physically active[11] and many environmental variables,...

Ngày tải lên: 14/08/2014, 08:21

20 183 0
ocial integration and its association with mortality among older people in china

ocial integration and its association with mortality among older people in china

... in social and cultural norms with regard to family and intergenerational relationships may lead to differences in the characteristics of social networks and their associations with health and longevity ... well as their associations with health and mortality (Berkman et al 2000; Fiori, Antonucci and Akiyama 2008; Litwin 2010; Seeman et al 1993) As Berkman and her colleagues (2000) have emphasized, ... integration and mortality separately for men and women Similarly, urban-rural differences in China are also remarkable at both social and structural level such as the extent of industralization,...

Ngày tải lên: 10/09/2015, 15:52

317 529 0
báo cáo hóa học: "Co-activation: its association with weakness and specific neurological pathology" pptx

báo cáo hóa học: "Co-activation: its association with weakness and specific neurological pathology" pptx

... parapyramidal and extrapyramidal, cortical, subcortical and cerebellar structures as well as sensory and association pathways It was therefore of interest to investigate patient groups with weakness ... weakness (usually bilaterally) diagnosed in one of the categories in table by a specialist neurologist according to their clinical assessment and b) able to stand and walk for a short distance ... a maximal isometric contraction of the quadriceps muscle was approximately 13% (+/- 5.8) [10] During functional tasks such as standing up from a chair as well as sitting down and walking up and...

Ngày tải lên: 19/06/2014, 10:20

8 482 0
báo cáo hóa học:" Aflatoxin levels, plasma vitamins A and E concentrations, and their association with HIV and hepatitis B virus infections in Ghanaians: a cross-sectional study" pdf

báo cáo hóa học:" Aflatoxin levels, plasma vitamins A and E concentrations, and their association with HIV and hepatitis B virus infections in Ghanaians: a cross-sectional study" pdf

... We measured aflatoxin levels and vitamins A and E concentrations in plasma of HIV-positive and HIV-negative Ghanaians chronically exposed to aflatoxin in their diets and examined the association ... sample of HIV-positive and HIV-negative males and females 19 years of age and older was conducted in Kumasi (a major maize and peanut-producing and consuming area) in the Ashanti Region of Ghana ... exposure was associated with lower Table Univariate statistics and distributions of vitamins A and E and plasma aflatoxin by HIV status HIV negative Variables Mean ± SD HIV positive Median Mean ±...

Ngày tải lên: 20/06/2014, 08:20

10 370 0
báo cáo khoa học: "Acceptance of shared decision making with reference to an electronic library of decision aids (arriba-lib) and its association to decision making in patients: an evaluation study" potx

báo cáo khoa học: "Acceptance of shared decision making with reference to an electronic library of decision aids (arriba-lib) and its association to decision making in patients: an evaluation study" potx

... for data analysis, carried out the study, performed the statistical analyses, and drafted the manuscript HK participated in the study design and coordination, the rationale for the data analyses, ... easy-to-understand graphic representation of risk information that takes the limited numeracy and statistical literacy of patients and physicians into account [20] The presentation of global risk information ... associations within patient variables [26] The Wald c2-test was used as a test statistic To enhance the interpretability of the results, we also analysed the data with traditional crosstab analyses...

Ngày tải lên: 10/08/2014, 11:20

9 407 0
Báo cáo y học: "Intracellular interactions between APOBEC3G, RNA, and HIV-1 Gag: APOBEC3G multimerization is dependent on its association with RNA" potx

Báo cáo y học: "Intracellular interactions between APOBEC3G, RNA, and HIV-1 Gag: APOBEC3G multimerization is dependent on its association with RNA" potx

... to evaluate defective mutants of Gag and A3 G BiFC assays to evaluate interactions between HIV-1 Gag, A3 G, and RNA-binding defective mutants of Gag and A3 G (E) BiFC assays to evaluate interactions ... A3 G-Gag interactions, and virion incorporation of A3 G Conclusion We have developed a robust BiFC assay to analyze intracellular A3 G -A3 G, A3 G-Gag, and A3 G-RNA interactions These studies show that A3 G ... generate NY -A3 G and CY -A3 G, NY and CY fragments were amplified using HIV-1-gag-NY and HIV-1-gag-CY as templates and subcloned into pcDNA-EYFP -A3 G vector, a derivative of pcDNA-APO3G The NY and...

Ngày tải lên: 12/08/2014, 23:21

20 296 0
Báo cáo y học: " Distribution of hepatitis C virus genotypes in patients infected by different sources and its correlation with clinical and virological parameters: a preliminary study" pptx

Báo cáo y học: " Distribution of hepatitis C virus genotypes in patients infected by different sources and its correlation with clinical and virological parameters: a preliminary study" pptx

... of patients 1a (N = 59) Age (years )a Male/Female (%male) Transmission of HCV Post-transfusional IVDA Sexual Hemodialysis Hemophilia Thalassemia Inmate Travel abroad Hejamate Other risk factors ... drafted the manuscript AK and S-MA conceived and coordinated the study, helped to draft the manuscript, and made the statistical analysis All authors read and approved the final manuscript References ... virus infection and related risk factors among Iranian hemodialysis patients Nephrology 2003, 8:256-260 Okamoto H, Okada S, Sugiyama Y, Kurai K, Iizuka H, Machida A, Miyakawa Y, Mayumi M: Nucleotide...

Ngày tải lên: 13/08/2014, 13:20

6 337 0
Báo cáo y học: " The diagnostic value of serum leptin monitoring and its correlation with tumor necrosis factor-a in critically ill patients: a prospective observational study" ppt

Báo cáo y học: " The diagnostic value of serum leptin monitoring and its correlation with tumor necrosis factor-a in critically ill patients: a prospective observational study" ppt

... using either ANOVA or Student’s t-test while non-parametric data were analyzed using Mann-Whitney U and c 2- tests Data were presented as mean and standard deviation A P-value of < 0.05 was considered ... SIRS and those with sepsis in patients suffering from a broad range of diseases in ICU and its correlation with other biomarkers Materials and methods After the study was approved by an investigational ... phase reactant Studies by Maruna et al., [18] and Yamaguchi et al., [19] demonstrated that a significant correlation between leptin and TNF-alpha can be a crucial regulator of leptin generation It...

Ngày tải lên: 13/08/2014, 20:21

9 306 0
Báo cáo y học: "A third-generation microsatellite-based linkage map of the honey bee, Apis mellifera, and its comparison with the sequence-based physical map" pps

Báo cáo y học: "A third-generation microsatellite-based linkage map of the honey bee, Apis mellifera, and its comparison with the sequence-based physical map" pps

... data are available with the online version of this paper Additional data file is a PDF file containing a microsatellite-based genetic map of the honey bee, AmelMap3 Additional data file is an ... Issue 4, Article R66 Solignac et al assemblies The simultaneous availability of genetic and physical data also provided the opportunity for mutual quality control and to reach a quasi-colinearity ... quantitative trait loci (QTLs) in association mapping studies A long genetic map, as in the honey bee, has both drawbacks and advantages The identification of candidate regions requires numerous markers...

Ngày tải lên: 14/08/2014, 07:21

14 261 0
Computational fluid dynamics (CFD) modelling of a continuous baking oven and its integration with controller design

Computational fluid dynamics (CFD) modelling of a continuous baking oven and its integration with controller design

... presentation and interpretation of the data and images With the availability of a wide range of commercial CFD softwares, CFD has began to gain its popularity in many applications Users are not required ... devise a CFD model that can absolutely accurately simulate the heat and mass exchanges in a real operating plant (Mirade et al., 2002) In addition, the specific food material properties and food ... considered as solid materials with constant density, while both heat capacity and thermal conductivity were functions varying with temperature A full factorial experimental plan was generated Temperature...

Ngày tải lên: 03/10/2015, 21:56

148 566 0
The herpetofauna of the peruvian dry forest along the andean valley of the marañón river and its tributaries, with a focus on endemic iguanians, geckos and tegus

The herpetofauna of the peruvian dry forest along the andean valley of the marañón river and its tributaries, with a focus on endemic iguanians, geckos and tegus

... flanks of the Chinchipe, Chamaya, Huancabamba and Utcubamba rivers and tributaries (Regions Piura, Cajamarca, Amazonas) southwards along the deep and narrow valleys of the Marañón River and its ... tamandua (Tamandua mexicana), the Sechuran fox (Pseudalopex sechurae), the puma (Puma concolor), the jaguar (Panthera onca), the ocelot (Leopardus pardalis) the tayra (Eira barbara), the collared ... the Region Amazonas, in Chacanto, Region Cajamarca and in various localities in the Region La Libertad (San Vicente/Pusac, Santa Rosa/El Tingo, Vijus, Chagual, Calemar, and Pias) at elevations between...

Ngày tải lên: 19/11/2015, 15:51

264 493 0
w