c upper percentiles of the x 2 distribution
In the Shadow of the Glen 2
... Maire Nic Shiubhlaigh MICHEAL DARA (a young herd) P J Kelly A TRAMP W G Fay SCENE {The last cottage at the head of a long glen in County Wicklow Cottage kitchen; turf fire on the right; ... crossing the hills when the fog is on them, the time a little stick would seem as big as your arm, and a rabbit as big as a bay horse, and a stack of turf as big as a towering church in the city of ... been locked into the Richmond Asylum, or maybe have run up into the back hills with nothing on me but an old shirt, and been eaten with crows the like of Patch Darcy the Lord have mercy on him...
- 11
- 563
- 0
A Brief Tour of the X Display Environment
... the security of X traffic across the network is to use ssh, the secure shell You can use the ssh utility to tunnel pretty much any network protocol across an encrypted connection, including X ... traffic In this case, the insecure X protocol is being packaged and carried within the secure encrypted ssh protocol As long as the ssh server and client are configured correctly, X traffic is ... MIT-MAGIC-COOKIE-1 MIT-MAGIC-COOKIE-1 4 7c8 72e9b9e 620 80749e3f6cb601e173 d778834a45880 121 769f333b41a119d1 427 868f7541d8f1a84538841fd362a3f 95bacf26a4e6ab1 0c6 a5bf95ac 228 ad8 Each record of this xauth output represents...
- 10
- 403
- 0
Tài liệu Báo cáo khoa học: Specific membrane binding of the carboxypeptidase Y inhibitor IC, a phosphatidylethanolamine-binding protein family member doc
... for IC and IC–CPY IC (A) or IC–CPY (B), the final concentration of which was lM, was added to PCbased liposomes (0.5 mgÆmL)1 of PE ⁄ PC, PC, PS ⁄ PC, and PtdIns ⁄ PC) in 20 mM Hepes (pH 7 .2) containing ... membrane binding of IC and IC–CPY IC (bold solid lines) or IC–CPY (solid lines), the concentration of which was lM, was injected for 90 s over the surface of the L1 sensor chip coated with the phospholipid ... (A) The binding interface between IC and CPY The IC residues at the buried surface in the complex with CPY constitute the N-terminal inhibitory reactive site (Ac-Met1–Phe7) and the secondary CPY-binding...
- 10
- 645
- 1
Tài liệu Báo cáo khoa học: Multiple promoters regulate tissue-specific alternative splicing of the human kallikrein gene, KLK11⁄hippostasin ppt
... 5¢-GGACTCAAGAGAGGAACCTG-3¢; F1b, 5¢-CT GCCTTGCTCCACACCTG-3¢; F 1c, 5¢-CTGCCGTCTCC GCCGCCACT-3¢; FU, 5¢-TCAAGCCCCGCTACATAG TT-3¢; and R3, 5¢-AGGAACCAAACACCAAGTGG-3¢ (Fig 2A) Luciferase promoter ... 5¢-CCAGGCCTCTAGAATTCTGCAGTT-3¢ The synthesized primer sequence contained a codon for the Ser instead of the Met Both PCR fragments were fused at the XbaI site and subcloned into pcDNA3.1 Myc-His ... transcript contains three first exons, exon 1b and 1c as well as exon 1a Similarly, exon 1b in transcript always spliced to exon despite the existence of exon 1c, which causes isoform KLK11 product...
- 9
- 544
- 0
Tài liệu Báo cáo khóa học: Quantitative analysis, using MALDI-TOF mass spectrometry, of the N-terminal hydrolysis and cyclization reactions of the activation 2 process of onconase pdf
... detrimental effect on the conformational stability of the enzyme Cytotoxic activity The effect of (Met1) removal on the cytotoxic properties of ONC was examined on K5 62 human erythroleukemic cells and ... investigating the effect of pH on the cyclization reaction, we expected that an acidic pH might enhance the rate of conversion of (Gln1)-ONC(M23L) to (Pyr1)ONC(M23L), based on previous studies on the conversion ... the cyclized fraction, defined as [(Pyr1)-ONC (M23L)/(Gln1)-ONC (M23L) + (Pyr1)-ONC (M23L)] during the first h of the reaction Guanidinium chloride concentration pH 6 .2 7 .2 8.0 Fig Comparison of...
- 9
- 704
- 0
Tài liệu Báo cáo khoa học: The Ets transcription factor ESE-1 mediates induction of the COX-2 gene by LPS in monocytes doc
... of the COX -2 promoter by ESE-1 in chondrocytes T ⁄ C2 8a2 cells were cotransfected with the pXP2 luciferase construct containing the )170 COX -2 promoter (pXP2 ⁄ COX -2) and the pCI ⁄ ESE-1 expression ... (the mutated bases are underscored): (a) COX -2 promoter Ets site #1, 5¢-GCT GAGGAGTAGCTGGACGTGCTCCTGAC-3¢; (b) COX -2 promoter Ets site #2, 5¢-CAGTCTTATAAAAACCAA GGTTCTCTCGGTTAGCGACC-3¢; (c) COX -2 ... Transcriptional activation of the COX -2 promoter by ESE-1 and LPS RAW cells were cotransfected with the pXP2 luciferase construct containing the COX -2 promoter (pXP2 ⁄ COX -2) starting either...
- 12
- 519
- 0
Báo cáo khoa học: Structural mobility of the monomeric C-terminal domain of the HIV-1 capsid protein pptx
... (reduced-spectral approach); furthermore, most of the residues in the loop (which forms the second helix in the dimeric non-mutated CAC protein [22 ,23 ]) were broad beyond detection in the HSQC experiments ... not relaxation-active; (b) in the second model, the se is relaxation-active; (c) the third model is identical to the first, except the conformational (or chemical) exchange on a 3308 microsecond-to-millisecond ... entropy can be calculated as a function of changes in polar and apolar surface areas of the binding interface, according to: DSsol = DCp ln(T ⁄ 385), where DCp is the heat capacity change of the...
- 13
- 421
- 0
Báo cáo khoa học: Structural features in the C-terminal region of the Sinorhizobium meliloti RmInt1 group II intron-encoded protein contribute to its maturase and intron ppt
... pmol of HPLC-purified primer WT (5¢-AATTGATCCCGCCCG CCTCGTTTTCATCGATGAGACCTGGACGAAGACGA ACATGGCGCCGCTGCGGGGC-3¢) using 50 lCi of [c- 32P]ATP (3000 CiÆmmol)1; GE Healthcare) and 100 units of T4 ... way The oligonucleotide WT was used as a template for amplification of a 70 bp PCR product with [5¢-32P]-labeled S70ds ⁄ UP (5¢-AATTGATCCCGCCCGCCTC-3¢) and S70ds ⁄ DN (5¢-GCCCCG CAGCGGCGCCATGTT-3¢) ... C, D, E, F, CL1 (chloroplast-like 1), CL2 (chloroplast-like 2) and ML (mitochondrialike)] [21 ,22 ,26 ] The RmInt1 IEP belongs to bacterial ORF class D [21 ,22 ] Moreover, unlike lactococcal and yeast...
- 11
- 398
- 0
Báo cáo khoa học: b-Secretase cleavage is not required for generation of the intracellular C-terminal domain of the amyloid precursor family of proteins pot
... 18 19 20 21 22 23 24 25 26 27 28 29 30 age of amyloid beta peptide during constitutive processing of its precursor Science 24 8, 1 122 –1 124 Sisodia SS (19 92) Beta-amyloid precursor protein cleavage ... Biochemistry 42, 6664–6673 Cao X & Sudhof TC (20 01) A transcriptionally [correction of transcriptively] active complex of APP with Fe65 and histone acetyltransferase Tip60 Science 29 3, 115– 120 Scheinfeld ... irrespective of the presence or absence of BACE1 The levels of APPsa increased to account for the loss of APPsb (soluble C- terminally truncated b-cleaved form of amyloid precursor protein) in BACE1...
- 16
- 549
- 0
Báo cáo khoa học: Cell type-specific transgene expression of the prion protein in Xenopus intermediate pituitary cells ppt
... examine the effect of the overexpressed Xenopus GFP–PrPC protein on the biosynthesis and processing of POMC as well as the secretion of the POMCderived products, we performed pulse and pulse–chase ... properties of the melanotrope cell with the technique of stable Xenopus transgenesis [25 ,26 ] to drive transgene expression of PrPC in a cell-speci c manner A DNA construct was made that encodes Xenopus ... into the biosynthesis of PrPC and our preliminary studies on the effect of the overexpressed PrPC show that the transgene product does not affect the functioning of a neuroendocrine cell With the...
- 16
- 431
- 0
Báo cáo khoa học: Functional expression of the quinoline 2-oxidoreductase genes (qorMSL) in Pseudomonas putida KT2440 pUF1 and in P. putida 86-1 Dqor pUF1 and analysis of the Qor proteins doc
... enzyme [2] In crude extracts of P putida 86 cells grown on quinoline, the speci c activity of Qor was about 0 .2 UÆmg)1 of protein, whereas the speci c Qor activity in crude extracts of succinate- ... KT2440 pUF1 seems to be correlated to a deficiency in the metal, not to a deficiency in the organic part of the molybdenum cofactor However, we cannot exclude that the pyranopterin part of the cofactor ... catalytic efficiency of the enzymes, or to alter their substrate specificity [64–66] Most of the molybdenum hydroxylases catalyzing the hydroxylation of N-heteroaromatic compounds contain the Mo-MCD cofactor...
- 11
- 724
- 0
Báo cáo khoa học: The proapoptotic member of the Bcl-2 family Bcl-2 / E1B-19K-interacting protein 3 is a mediator of caspase-independent neuronal death in excitotoxicity pot
... hypoxia-inducible factors Excitotoxicity involves Ca2+ overloading and concomitant generation of reactive oxygen species, which has been shown to trigger hypoxia-induced transcription [22 ] Therefore, ... apoptotic pathways Brain Res 916, 23 9 24 8 20 Bruick RK (20 00) Expression of the gene encoding the proapoptotic Nip3 protein is induced by hypoxia Proc Natl Acad Sci USA 97, 90 82 9087 21 Guo K, ... Mathieu CE, Simon MC & Schumacker PT (1998) Mitochondrial reactive oxygen species trigger hypoxia-induced transcription Proc Natl Acad Sci USA 95, 11715– 11 720 23 Paxinos G & Watson C (1986) The...
- 9
- 388
- 0
Đề tài " A resolution of the K(2)-local sphere at the prime 3 " pot
... x2 , x3 ]Σ3 ⊆ S(F )C3 There is at least one other obvious element invariant under the action of C3 : set (3.10) = x2 x2 + x2 x3 + x2 x1 − x2 x1 − x2 x3 − x2 x2 3 This might be called the “anti-symmetrization” ... is clear that the C3 -action fixes the coset eG24 ; furthermore C3 ω −1 is another complement to K in S2 and therefore C3 C3 ⊂ KC3 C3 = S2 C3 = K C3 ω −1 C3 ⊂ K C3 , and hence the class of ... t2 = ψ 8 02 P GOERSS, H.-W HENN, M MAHOWALD, AND C REZK We have (E∗ )C3 ∼ W[ [c3 ∆−1 ]] [c4 , c6 , δ ±1 ]/ (c2 − c3 = 27 ∆) = C1 2 ∼ −1 ±1 /2 (E∗ ) ]/ (c2 − c3 = 27 ∆) = Z3 [ [c ∆ ]] [c4 , c6 , (−∆) C6 ...
- 47
- 354
- 0
Báo cáo khóa học: Three cyclin-dependent kinases preferentially phosphorylate different parts of the C-terminal domain of the large subunit of RNA polymerase II potx
... directly compare the phosphorylation of the CTD or synthetic CTD derivatives by CDK7/CycH/MAT1, CDK8/CycC and CDK9/ CycT1 [25 ,27 –31] CDK7/CycH/MAT1 and CDK8/CycC preferentially phosphorylate the ... and the corresponding enzymes could have additional effects on the substrate specificities of CDK7/CycH/MAT1, CDK8/CycC and CDK9/CycT1 These effects are beyond the scope of the current study The ... stressing the specificity of CDK7/CycH/MAT1 and CDK8/CycC for S5 of the YSPTSPS consensus and the preference of CDK9/CycT1 for S2 None of the substrates was phosphorylated in the absence of a kinase...
- 11
- 389
- 0
Báo cáo khoa học: The C-terminal region of the proprotein convertase 1⁄ 3 (PC1⁄ 3) exerts a bimodal regulation of the enzyme activity in vitro pdf
... approach, we obtained 10 mg of purified CT-peptide per liter of bacterial culture Effect of the CT-peptide on mPC1 ⁄ enzymatic activity The effect of various concentrations of the purified CT-peptide ... the activator A, thus favoring the increased release of P from the EAESA complex rather than the ES complex As seen in Fig 3, the CT-peptide influences the speed of reaction, because the velocity ... 3 921 3– 3 922 2 37 Nour N, Basak A, Chretien M & Seidah NG (20 03) Structure–function analysis of the prosegment of the proprotein convertase PC5A J Biol Chem 27 8, 28 86– 28 95 38 Teuchert M, Berghofer...
- 10
- 305
- 0
Báo cáo khoa học: Role of the N- and C-terminal regions of the PufX protein in the structural organization of the photosynthetic core complex of Rhodobacter sphaeroides pptx
... without PufXD2)19 is isolated on the sucrose gradient The occurrence of a mixed population of LH1–RC core complex in the ICM would explain the variability in the duration of the lag of cytochrome ... used to extract PufX We can suppose that the discrepancy is related to the presence of the LH2 which could influence the shortening processes of the assembled PufX protein The exchange of ubiquinone ... light of our results The presence in vitro of a less stable dimer in the mutant PufXD2)7 neither affects the photosynthetic capability of the bacteria nor the efficiency of exchange of the ubiquinol...
- 9
- 547
- 0
Báo cáo Y học: Arginine 121 is a crucial residue for the specific cytotoxic activity of the ribotoxin a-sarcin potx
... mutagenic primers used were 50 -CCTGGCCCGGCGAAGGTCA TCTACACC-30 for R 121 K and 50 -CCTGGCCCGGCG CAGGTCATCTACACC-30 for R 121 Q (the site of mutation is underlined) The E coli strains used were BW313 ... Biochem 26 8) 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 cytotoxin a-sarcin behaves as a cyclizing ribonuclease FEBS Lett 424 , 46 –48 ´ ´ ˜ Perez-Canadillas, J.M., Campos-Olivas, R., Lacadena, ... ellipticity at 22 0 nm, expressed in units of degrees:cm2:dmol21 Km (mM ) kcat (s21) kcat/Km (M 21 :s21) Wild-type R 121 K R 121 Q 40 ^ 36 ^ 27 ^ (27 .0 ^ 1.0) Â 1 025 (1 .2 ^ 0 .2) Â 1 025 (7.9 ^ 0.3) Â 1 025 ...
- 7
- 434
- 0
university press of kentucky the philosophy of the x-files sep 2007
... political relevance of The X- Files They begin by articulating the necessary conditions for sound democratic government and argue that the kind of secretive political tactics employed by the Syndicate ... and Fictions: Exploring Emotion and Belief in Fight the Future 23 2 Christopher R Trogan Appendix A: The X- Files Mythology Appendix B: The X- Files Debriefed Contributors Index 26 9 26 5 24 3 24 7 20 9 ... intellectual tradition Peirce’s use of the term “abduction” for the logic of hypothesis creation accurately describes Mulder’s activity, along with the ontological and epistemological commitments of...
- 296
- 236
- 0
báo cáo hóa học:" Phase I/II open-label study of the biologic effects of the interleukin-2 immunocytokine EMD 273063 (hu14.18-IL2) in patients with metastatic malignant melanoma" docx
... before the first infusion (C1 D1), during the first cycle infusion (C1 D2 and C1 D3) and then immediately before (C2 D1) and during the second cycle of EMD 27 3063 (C2 D2, C2 D3) Depicted are the serum concentrations ... Value of Cycle Comparisons CD4+ 0. 020 3 0.1 827 - - CD8+ 0. 020 7 0.1 827 - - CD56+ - - 0. 125 0 - CD16+/CD56+ - - 1.0 - CD25+ 0.31 92 1.0 - - CD27+ 0.0709 0. 425 4 - - NK+ granzyme B+ 0 .26 23 1.0 - - CD8+ ... CD16, CD25, CD27 and CD56 by flow cytometry; intracellular granzyme B by flow cytometry as a surrogate marker of the cytotoxic potential of circulating lymphocytes; NK cytotoxic activity against the...
- 11
- 673
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25