C Programming Tutorial doc
... blocks of the C programming language, let us look a bare minimum C program structure so that we can take it as a reference in upcoming chapters. C Hello World Example A C program basically consists ... fraction */ Character constants Character literals are enclosed in single quotes e.g., 'x' and can be stored in a simple variable of char type. A character literal can be a plain character ... produces efficient programs. It can handle low-level activities. It can be compiled on a variety of computer platforms. Facts about C C was invented to write an operating system called...
Ngày tải lên: 11/03/2014, 08:20
Symbian OS Explained Effective C++ Programming for Smartphones phần 7 pdf
Ngày tải lên: 13/08/2014, 08:21
Tutorial for Novices to Agilent’s Advanced Design System (ADS)
... © Dr.B.S.Virdee 10 9. Calculate the length of MLOC and Change Parameters of Open Circuit Stub (MLOC) ã Select/highlight the part and click on Start Line Calc under Tool/LineCalc menu. ã Insert substrate ... Smith Chart) â Dr.B.S.Virdee 3 1. Create a NEW Project Directory. ã Create a new project by clicking on New Directory icon ã Then, you will have the window below. Click on Length Unit and select ... part, push ESC key, or select ‘End commend ESC’ in the menu by clicking right mouse button. Category Part Window Select TLine-Microstrip category Use the scroll bar, and find/select MLIN. © Dr.B.S.Virdee 15 14....
Ngày tải lên: 15/10/2012, 08:33
Tài liệu Matlab tutorial for systems and control theory pdf
... directory, checking the path to the working directory, and changing the working directory. MATLAB checks for MATLAB files in certain directories which are controlled by the command ‘path’. The command ... MathWorks, Inc.) whose URL is http://www.mathworks.com. Full documentation can be purchased by contacting The MathWorks. 2 Getting Started On Project Athena, MATLAB can be accessed directly from ... 5.1 Arithmetic matrix operations The basic arithmetic operations on matrices (and of course scalars which are special cases of matrices) are: + addition - subtraction * multiplication / right...
Ngày tải lên: 12/12/2013, 07:15
Tài liệu C Programming for Embedded Systems docx
... to C necessary for targeting an embedded environment, and the common components of a successful development project. C is the language of choice for programming larger microcontrollers (MCU), ... instructions to the COPCR register. Interestingly, the COP watchdog is dependent upon the system clock; a clock monitor circuit resets the MCU if the clock stops, and thereby renders the COP watchdog ... manoeuvre. Programming the prescalar and starting the clock are tasks of the software developer. Knowing the processor clock frequency, and choosing correct prescalar values, you can achieve accurate...
Ngày tải lên: 22/12/2013, 02:17
Tài liệu Megabit Modems 410F/420F ADSL Modem Pair for Advanced LAN Applications pdf
... users secure, high-speed connectivity to today’s growing array of remote resources. Whether accessing the Internet, connecting remote network sites, or telecommuting, ADC has the right modem for ... Configuration Protocol (DHCP) server to provide network configuration information including IP addresses to LAN devices ã Web browser configuration and management tool to allow one-click selection of ... Pair for Advanced LAN Applications Megabit Modems đ 410F and 420F are point-to-point bridging and routing solutions targeted for advanced LAN extension applications. The Megabit Modem 410F (local...
Ngày tải lên: 17/01/2014, 10:20
Tài liệu Real-Time Digital Signal Processing - Appendix C: Introduction of C Programming for DSP Applications ppt
... %f indicates the number is floating-point data. In addition, the formatted I/O functions also recognize %d for decimal integers, %x for hexadecimals, %c for characters, and %s for character strings. The ... PROGRAMMING FOR DSP APPLICATIONS Appendix C Introduction of C Programming for DSP Applications C has become the language of choice for many DSP software developments not only because of its powerful commands ... example. C compiler translates high-level C programs into machine language that can be executed by computers or DSP proces- sors such as the TMS32 0C5 5x. The fact that C compilers are available for...
Ngày tải lên: 25/01/2014, 19:20
Tài liệu Practical C Programming Third Edition pdf
... low-cost MS-DOS C+ + compiler called Turbo C+ +. This compiler will compile both C and C+ + code. We will describe only how to compile C code. Turbo C+ + is ideal for learning. The command line for ... generic cc compiler or the Free Software Foundation’s gcc compiler. For MS-DOS/Windows users, instructions are included for Borland C+ +, Turbo C+ +, and Microsoft Visual C+ +. (These compilers compile ... The commands for the most popular compilers are listed below. UNIX cc compiler (generic UNIX) Most UNIX-based compilers follow the same generic standard. The C compiler is named cc, and to compile...
Ngày tải lên: 14/02/2014, 20:20
Tài liệu Beej''''s Guide to C Programming pdf
... work is licensed under the Creative Commons Attribution- Noncommercial- No Derivative Works 3.0 License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-nd/3.0/ ... this is executed once, because the continuation condition is // not checked until after the body of the loop runs: do { ii Contents 1. Foreward 1 1.1. Audience 1 1.2. Platform and Compiler 1 1.3. ... after, you can use calloc() to do that in one call. I wish this section on calloc() were more exciting, with plot, passion, and violence, like any good Hollywood picture, but this is C programming...
Ngày tải lên: 16/02/2014, 08:20
PERIPHERAL BLOOD BASED C-PCR ASSAY FOR DIAGNOSING EXTRA-PULMONARY TUBERCULOSIS pdf
... was: Forward primer (FW) 5- TCCGCTGCCAGTCGTCTTCC-3 and Reverse primer (RW) 5- GTCCTCGCGAGTCTAGGCCA – 3. Amplification reaction was performed in 25 l of master cocktail containing ... quantification of mycobacterial Fig. 6—Representative agarose gel electrophoresis picture(s) of C- PCR amplified products for the calculation of mycobacterial load from peripheral blood specimens ... used specimen for revealing the presence of tubercle bacilli in TB. However, its clinical significance in EPTB is very discouraging 3 . The diagnosis in such cases posses great challenge...
Ngày tải lên: 06/03/2014, 04:20
Distributed Databases Dr. Julian Bunn Center for Advanced Computing Research Caltech pdf
... Distributed Databases, 2001 22 Concurrency Control Concurrency Control Locking Locking ? ? How to automatically prevent How to automatically prevent concurrency bugs? concurrency bugs? ? ? Serialization ... times more storage ? ? Placement strategies: Placement strategies: ? ? Dynamic: cache on demand Dynamic: cache on demand ? ? Static: place specific Static: place specific Catalog J.J.Bunn, Distributed ... locking) ? ? Greater concurrency for locks: Greater concurrency for locks: ? ? Granularity: objects or containers or server Granularity: objects or containers or server ? ? Mode: shared or exclusive...
Ngày tải lên: 07/03/2014, 23:20
Báo cáo khoa học: Selective modulation of protein C affinity for EPCR and phospholipids by Gla domain mutation pdf
... the concentration of sEPCR, an anti-EPCR monoclonal antibody (RCR-2) was covalen- tly immobilized on a carboxymethylated dextran (CM5) sensor chip (BIAcore) using amine coupling chemistry, according ... procedures). A nonreactive mAb was used as a control for nonspeci c binding in the reference flow cell. Increasing concentrations of wild-type sEPCR (13–106 n M) were injected across both flow cells. ... bind anionic phospholipid surfaces [16,26,27] and is there- fore crucial for its activity. The crystal structures of recombinant sEPCR, and sEPCR in complex with the Gla domain of protein C, have recently...
Ngày tải lên: 16/03/2014, 18:20
Robert l wood c programming for scientists and engineers
... 2 C programming for scientists and engineers as C ++, for engineering and scientific calculations because the resulting programs can make more efficient use of the ... Introduction Executable statements are those that either process information in some way, for example performing calculations, or use information to control and co-ordinate such processing. ... structures and to access their members indirectly. Chapter review This chapter has concentrated on the different types of data that can be processed in C programs. C specifies a small ...
Ngày tải lên: 19/03/2014, 14:13
C Programming for Embedded Systems ppt
... ensures that application source code can be recompiled for different microcontroller targets. Page 11 (c) Wait for keystroke (1) If key is pressed, wait for debounce period and check again. (d) ... 3.2 shows the COP8 vector table, as required for the COP8SAA7 device. The rank is as enforced by the VIS instruction. Table 3.2 COP8 vectored interrupts Rank Source Description Vector Address ... recorded in main (or data) memory: the Microchip PIC and Scenix SX architectures use a stack space outside of user RAM. It is important to check the depth of return information stored by function...
Ngày tải lên: 22/03/2014, 09:20