c polymodal nociceptors and a delta and a beta fibers
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
Ngày tải lên :
18/02/2014, 17:20
... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products were ... these cells may cause a dysfunctional cardiac flow and cause the sudden death of the transgenic mice, although it remains to be determined whether T antigen-expressing cardiac valves are functionally ... physiological functions and intracellular signaling Thus, our system provides an accessible method to examine the endothelial cell biology of the mouse, and will accelerate the molecular and cellular analysis...
- 11
- 873
- 0
Báo cáo khoa học: Role of the C-terminal extension in a bacterial tyrosinase Michael Fairhead and Linda Thony-Meyer doc
Ngày tải lên :
06/03/2014, 11:20
... peach (Prunus persica L Cv Catherina) Molecular properties and kinetic characterization of soluble and membrane-bound forms J Agric Food Chem 55, 10446–10451 31 Gandia-Herrero F, Garcia-Carmona ... compartmentalized cell plan with members of bacterial phylum Planctomycetes BMC Microbiol 9, 20 Plonka PM & Grabacka M (2006) Melanin synthesis in microorganisms-biotechnological and medical aspects Acta ... temperature and A5 46 was measured, using water as a reference A standard curve using 0–165 lm CuCl2Æ2H2O was also made and gave a calculated e for the copper biquinoline complex of 5982 m)1Æcm)1 Trypsinization...
- 13
- 778
- 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
Ngày tải lên :
07/03/2014, 05:20
... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... late-endosome ⁄ vacuole Traf c 2, 622–630 Piper RC, Cooper AA, Yang H & Stevens TH (1995) VPS27 controls vacuolar and endocytic traf c through a prevacuolar compartment in Saccharomyces cerevisiae J Cell ... superfamily typically contain one or two ATPase domains that assemble into one or two stacked hexameric rings The ATPase catalytic site is located at the interface between adjacent ATPase domains...
- 23
- 490
- 0
The Project Gutenberg EBook of The Car of Destiny by C. N. Williamson and A. M. Williamson pot
Ngày tải lên :
07/03/2014, 11:20
... without making myself ridiculous by a foreign accent As for my brown face and black eyes, many a Cornishman has a face as brown and eyes as black; therefore, I edited the name of Triana into Cornish ... sits always in the tonneau, had already heard all about the King's automobile, and was primed with particulars He leaned across to describe its appearance, as well as mention the make; and when ... and went alone, rather than drag Dick into an affair which might end disagreeably I did not put myself forward, but stood for a while and watched the dancers, waiting for my chance Carmona had...
- 424
- 1.3K
- 0
Báo cáo khoa học: The 3¢-UTR of the mRNA coding for the major protein kinase C substrate MARCKS contains a novel CU-rich element interacting with the mRNA stabilizing factors HuD and HuR ppt
Ngày tải lên :
08/03/2014, 08:20
... synthetic oligonucleotides (sense: 5¢-CCC CGG GCC CGA ATT CCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT TTT TTT TTC TCG AGC CCC-3¢; antisense: 5¢-GGG GCT CGA GAA AAA AAA AAA GAA AGA AAG ... AAG AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGG AAT TCG GGC CCG GGG-3¢) representing base pairs 1830–1881 of the MARCKS cDNA [38] and cloning the resulting doublestranded DNA into the SmaI site ... by PCR using clone kuniZAP-265114 as template and BamHI and SmaI sites containing primers (sense: 5¢-TAG CGG ATC CGA GCC TCA GGT GTC AAA TGG-3¢; antisense: 5¢-AAT GCC CGG GTC AGG ACT TGT GGG CTT...
- 16
- 754
- 0
Trade and Macroeconomics Division International Food Policy Research Institute 2033 K Street, N.W. Washington, D.C. 20006, U.S.A. ppt
Ngày tải lên :
15/03/2014, 22:20
... different data sources adopted, the SAM contains all available data but such data are inconsistent leading to imbalances in the SAM accounts In such a situation, there is no balanced SAM available ... Structure of a Social Accounting Matrix (SAM) A SAM is a square matrix whose corresponding columns and rows present the expenditure and receipt accounts of economic actors Each cell represents a payment ... estimating a social accounting matrix (SAM) for a recent year is to find an efficient and cost-effective way to incorporate and reconcile information from a variety of sources, including data from...
- 37
- 299
- 0
Báo cáo khoa học: Structure and potential C-terminal dimerization of a recombinant mutant of surfactant-associated protein C in chloroform/methanol ppt
Ngày tải lên :
16/03/2014, 16:20
... Ha and side chain protons The spin systems of Lys10 and Arg11 are indicated by rectangles as both contain a second HN in the side chain The N-terminal Gly1 appears as a weak and very broad peak ... light-scattering and CD experiments reveal the existence of an a- helical dimer at acidic pH ([25]; A Seidl, G Maccarone, N Youhnovski, K P Schaefer and M Przybylski, unpublished data) CNBr cleavage ... broad peak All Ha chemical shifts of residues 5–31 show an upfield shift compared with random-coil data indicating an a- helical structure in an empirical pattern-recognition approach [13,16] (B)...
- 10
- 426
- 0
Báo cáo khoa học: The )148 to )124 region of c-jun interacts with a positive regulatory factor in rat liver and enhances transcription Dipali Sharma*, Sujata Ohri and Aparna Dixit ppt
Ngày tải lên :
23/03/2014, 20:22
... by Garg et al [23] Two complementary synthetic oligonucleotides [ (a) 5¢-CTAGGGTGGAGTCTCCATGGT GAC-3¢ ()148 to )124 of c- jun) and (b) 5¢-GTCACCATG GAGACTCCA-3¢ (designed in such a way as to leave ... )124 of c- jun and stimulates transcription Materials and methods Reagents and animals All chemicals were of reagent grade and were from Sigma Chemical Co unless stated otherwise Healthy female inbred ... the reaction mixture was placed on ice and UV irradiated (254 nm) for 15 [25] Following irradiation, the mixture was separated by SDS/PAGE (15% acrylamide) and analysed by autoradiography changes...
- 9
- 449
- 0
Báo cáo khoa học: MicroRNA-23b mediates urokinase and c-met downmodulation and a decreased migration of human hepatocellular carcinoma cells doc
Ngày tải lên :
29/03/2014, 23:20
... cell extracts from control cells (lanes 1, 2, 4, and 5) and transfected cells (lanes and 6) at 48 and 72 h after transfection results showed a greater decrease in luciferase activity as compared ... hours and 72 h after transfection, total RNA isolations from control cells (lanes 1, 2, 4, and 5) and transfected cells (lanes and 6) were examined by RT-PCR to detect uPA mRNA (A) and c- met mRNA ... using RNU66 as an internal control RT-PCR analysis (Agilent) and real-time PCR Total RNA of transfected and nontransfected cells was extracted with Trizol reagent according to the manufacturer’s...
- 17
- 287
- 0
Báo cáo sinh học: " Repressor of temperate mycobacteriophage L1 harbors a stable C-terminal domain and binds to different asymmetric operator DNAs with variable affinity" ppt
Ngày tải lên :
18/06/2014, 18:20
... (His-CI), a vector pSAU1180 was constructed by cloning an L1 DNA [12,17] (amplified with primers, LCP2: 5'AAGCTTCCTTTCGTTGCGCGGC and LCP3: 5'GAATTCATGAGCGGCAAAATC) to pET2 8a (Novagen, USA) This cloning ... change of each of His-CI and CTD at 42 C compared to those at 30 C Figure CD-spectra of His-CI and CTD CD-spectra of His-CI and CTD Far UV CD-spectra of His-CI and CTD (64–183 amino acid residues) ... than half of that of λ phage [1] The data also indicate that CTD is comparatively more compact than NTD at room temperature CD spectra of CI, His-CI and CTD CD spectra measurement of proteins can...
- 8
- 494
- 0
Báo cáo sinh học: " Involvement of PKR and RNase L in translational control and induction of apoptosis after Hepatitis C polyprotein expression from a Vaccinia virus recombinant" doc
Ngày tải lên :
19/06/2014, 08:20
... virus infection in vitro Proc Natl Acad Sci U S A 2005, 102:9294-9299 Rowlands AG, Panniers R, Henshaw EC: The catalytic mechanism of guanine nucleotide exchange factor action and competitive ... NS4B Core 20 20 Figure Construction and characterization of the recombinant VT7-HCV7.9 virus Construction and characterization of the recombinant VT7-HCV7.9 virus A: Generation of recombinant ... and a large open reading frame (ORF) encoding a 3010–3030 amino acid polyprotein that is co- and posttranslationally cleaved by cellular and viral proteases to produce mature structural (Core,...
- 19
- 373
- 0
Báo cáo hóa học: " Repressor of temperate mycobacteriophage L1 harbors a stable C-terminal domain and binds to different asymmetric operator DNAs with variable affinity" ppt
Ngày tải lên :
20/06/2014, 01:20
... (His-CI), a vector pSAU1180 was constructed by cloning an L1 DNA [12,17] (amplified with primers, LCP2: 5'AAGCTTCCTTTCGTTGCGCGGC and LCP3: 5'GAATTCATGAGCGGCAAAATC) to pET2 8a (Novagen, USA) This cloning ... change of each of His-CI and CTD at 42 C compared to those at 30 C Figure CD-spectra of His-CI and CTD CD-spectra of His-CI and CTD Far UV CD-spectra of His-CI and CTD (64–183 amino acid residues) ... than half of that of λ phage [1] The data also indicate that CTD is comparatively more compact than NTD at room temperature CD spectra of CI, His-CI and CTD CD spectra measurement of proteins can...
- 8
- 362
- 0
báo cáo hóa học:" Involvement of PKR and RNase L in translational control and induction of apoptosis after Hepatitis C polyprotein expression from a Vaccinia virus recombinant" docx
Ngày tải lên :
20/06/2014, 04:20
... virus infection in vitro Proc Natl Acad Sci U S A 2005, 102:9294-9299 Rowlands AG, Panniers R, Henshaw EC: The catalytic mechanism of guanine nucleotide exchange factor action and competitive ... NS4B Core 20 20 Figure Construction and characterization of the recombinant VT7-HCV7.9 virus Construction and characterization of the recombinant VT7-HCV7.9 virus A: Generation of recombinant ... and a large open reading frame (ORF) encoding a 3010–3030 amino acid polyprotein that is co- and posttranslationally cleaved by cellular and viral proteases to produce mature structural (Core,...
- 19
- 389
- 0
Báo cáo khoa học: "Hepatic splenosis mimicking HCC in a patient with hepatitis C liver cirrhosis and mildly raised alpha feto protein; the important role of explorative laparoscopy" potx
Ngày tải lên :
09/08/2014, 04:20
... diagnosis of splenosis, as well as excluding coexistent malignancy This had a significant impact of clinical plans and patients management It is already recognized that laparoscopy provides a ... was a persistent alcoholic and was prone to frequent binging A computerized tomography scan (CT) demonstrated a cirrhotic liver with a × 2.7 cm focal hypervascular nodule, lying peripherally at ... in case of suspected lesions especially in patients who had previous splenectomy Correct diagnosis is essential and can significantly influence patient management We propose that laparoscopic...
- 4
- 451
- 0
báo cáo hóa học:" Identification of a public CDR3 motif and a biased utilization of T-cell receptor V beta and J beta chains in HLA-A2/Melan-A-specific T-cell clonotypes of melanoma patients" potx
Ngày tải lên :
18/06/2014, 15:20
... aNucleotides 5' J region C GGG TTGGG CAGCCCCAGCA T .TATGGCTACACC .CAGCCCCAGCA T .CAGCCCCAGCA T .CAGCCCCAGXX X .CAGCCCCAGXX X .CAGCCCCAGCA T TTCACCCCT CCAC TCAGCCCCAGXX X TCAGCCCCAGXX X TCAGCCCCAGCA ... TCAGCCCCAGCA T .CAGCCCCAGCA T .CAGCCCCAGCA T .CAGCCCCAGCA T TCAGCCCCAGCA T CTATGGCTACXXX TCAGCCCCAGCA T not available tions 105, 106, 107 and 114 in the majority of canonical TRBV and TRBJ chains, ... C C CAGGGGGC TCGG 42 GCCAGCAGT G T .ACAGGGG CTCGG D/b GCCAGTAGTAT GACAGGG CTAGGG AGTGC GCCCGAT .ACAGGG CTTGGC GCCAGCAG ATACCA GGGAC TAGGA 39 GCCTGGAGTGT C C CAGGG CTAGG NA XXXXXXAGT CAT...
- 14
- 532
- 1
C# Coding Standards and Best Programming Practices
Ngày tải lên :
18/08/2012, 08:47
... lower case Example: BackColor ackC Camel Casing - First character of all words, except the first word are Upper Case and other characters are lower case Example: backColor ackC Use Pascal casing ... Naming Conventions and Standards Note : The terms Pascal Casing and Camel Casing are used throughout this document Pascal Casing - First character of all words are Upper Case and other characters are ... layer (N-Tier) architecture http://www.dotnetspider.com/tutorials/BestPractices.aspx Never access database from the UI pages Always have a data layer class which performs all the database related...
- 18
- 809
- 1
Phân tích chiến lược công ty sữa vinamilk trên cơ sở lựa chọn các phương án hội nhập dọc.doc
Ngày tải lên :
24/09/2012, 17:21
... Trong c ng ty a dạng hoá tồn hai c p chiến lư c tách bạch, là: chiến lư c kinh doanh (hay chiến lư c cạnh tranh) chiến lư c công ty (c p độ toàn c ng ty) Mỗi đơn vị kinh doanh c ng ty a dạng ... sản xuất chất gốm (ceramic) cho bán dẫn C c công ty bán đầu cho nhà chế tạo sản phẩm trung gian C c nhà chế tạo trung gian bao gồm Seagate, Micron Technology, chuyển h a vật liệu gốm, h a chất kim ... trưng th a thuận c ng ty đồng ý cung c p cho c ng ty kh c công ty kh c đồng ý liên t c mua từ nhà cung c p đó; hai cam kết tìm c ch th c hạ thấp chi phí nâng cao chất lượng đầu vào cho trình...
- 36
- 2.6K
- 19
Cú sốc xăng dầu ảnh hưởng đến các thị trường như thế nào.doc
Ngày tải lên :
01/10/2012, 16:59
... tế a t mư c cao Tại Mỹ, Cu c dự trữ liên bang lo sợ về a p lư c lạm phát tăng cao a tích c c triển khai ca c chính sách tiền tệ thắt chặt Chính sách tiền tệ châu Âu cũng ... cho ca c lư a chọn nói Điều này a đươ c nêu ca c sở về chính sách chính dịch tranh c cu a cả Bush và Kerry năm 2004 Tuy nhiên ca c giải pháp nói sẽ không thể đến một cách ... giải pháp này thì vấn đề lại nằm ở chỗ ca c phát hiện và khai tha c dầu mỏ tại những vùng đươ c bảo vệ về mặt môi trường Alaska hay ca c đi a điểm ngoài xa kha c chỉ sản...
- 7
- 2.4K
- 15
Báo cáo y học: "Hepatitis C Virus Serologic and Virologic Tests and Clinical Diagnosis of HCVRelated Liver Disease"
Ngày tải lên :
02/11/2012, 09:56
... Qualitative Assay Amplicor HCV Monitor® v2.0 Cobas® Amplicor HCV Monitor v2.0 LCx HCV RNA Quantitative Assay Versant® HCV RNA 3.0 Assay Cobas® TaqMan HCV Test Abbott RealTime Roche Molecular ... polymerase chain reaction, TMA : transcription-mediated amplification, bDNA : “branched DNA“, NA : not applicable *for 0.2 ml or 0.5 ml of plasma analyzed, respectively Assay Manufacturer Amplicor® HCV ... (Abbott Diagnostic); one is based on bDNA technology, Versant® HCV RNA 3.0 Assay (Bayer Healthcare) ; and two are based on real-time PCR amplification, Cobas® TaqMan HCV Test, which can be coupled...
- 6
- 612
- 0