... to carbonyl group and bands at 1130, 1040 cm-1 are corresponding to nitrite and hyponitrite groups present in TCNS5 and they are absent in TCNS0 which shows successful doping of nitrogen into ... increasing the photocatalytic activity in visible light region [3–9] The preparation of doped TiO2 resulting in a desired band gap narrowing and an enhancement in the phtocatalytic activity under ... TCNS15 TCNS10 TCNS5 TCNS3 TCNS1 TCNS0 Absorbance (a.u) Absorbance (a.u) TCNS15 TCNS10 TCNS5 TCNS3 TCNS1 TCNS0 800 Wavelength ( nm ) 1.6 1.8 2.0 2.2 2.4 2.6 2.8 3.0 3.2 3.4 3.6 3.8 4.0 Bandgap...
Ngày tải lên: 26/03/2014, 00:20
... Enantioselective H/D exchange reaction 2.1 Introduction Hydrogen/deuterium (H/D) exchange between organic compounds and deuterium sources is very important for a wide range of applications such ... deprotonation/deuteriation process 2.2 Enantioselective H/D exchange of -fluorinated aromatic ketones 2.2.1 Synthesis of -fluorinated aromatic cyclic ketones and chiral bicyclic guanidine catalyst ... the chiral bicyclic guanidine catalyst 25 The deuterium incorporation was monitored by H NMR and enantioselectivity was checked by chiral HPLC The initial experiment was carried out in THF in the...
Ngày tải lên: 10/09/2015, 15:51
Alpha fluorinated aromatic ketone as nucleophile in asymmetric organocatalytic c n and c c bonds formation reactions 4
... Enatioselective C- N bond formation 3.1 Introduction The catalytic, enantioselective, direct C- N bond formation reaction using carbonyl compounds and nitrogen sources, such as azodicarboxylates, ... chromanone moiety can be found in flavanones and many natural products and they are important compounds in medicinal and biological chemistry, due to their antitumor and anti-inflammatory properties.8 ... 3.8 Other -fluorinated compounds tested in asymmetric amination a Conversion of corresponding products determined by TLC bChiral HPLC ananlysis for corresponding products Inspired by this result,...
Ngày tải lên: 10/09/2015, 15:51
Alpha fluorinated aromatic ketone as nucleophile in asymmetric organocatalytic c n and c c bonds formation reactions 4a
... -fluorinated aromatic ketones in the asymmetric Mannich and Michael reactions 4.2 Asymmetric Mannich reaction of -fluorinated aromatic ketones 4.2.1 Synthesis of imines and pentanidines; Pentanidines ... asymmetric Mannich and Michael reactions are much more useful reactions for preparation of chiral functionalized organic molecules Recently, more efforts were donated to the development of efficient chiral ... Enatioselective C- C bond formation 4.1 Introduction Asymmetric C- C bond formation reactions are important reactions in organic synthesis Among the various asymmetric organic reaction, asymmetric...
Ngày tải lên: 10/09/2015, 15:51
Alpha fluorinated aromatic ketone as nucleophile in asymmetric organocatalytic c n and c c bonds formation reactions 5
... 124.3 min; minor isomer: 132.8 5.4 Protocol for bicyclic guanidine catalyzed asymmetric C- N bond formation reaction and characterization of products 2-Fluoro-3,4-dihydronaphthalen-1(2H)-one 82d ... (136) 121 Experimental Colorless oil LRMS (ESI) m/z 551.3 (M+Na+); 5.5 Protocol for bicyclic guanidine catalyzed asymmetric C- C bond formation reactions and characterization of products Procedures ... MHz, CDCl3, ppm): δ = 159.3, 95.1, 26.8, 7.5; LRMS (ESI) m/z 336.7 (M + Na+) 5.2.2 Preparation and characterization of catalysts Bicyclic guanidine 25 was prepared according to the published procedure.5...
Ngày tải lên: 10/09/2015, 15:51
Alpha fluorinated aromatic ketone as nucleophile in asymmetric organocatalytic c n and c c bonds formation reactions
... which was conducted in the presence of chiral palladium complex For the acyclic and cyclic electrophiles, the FBSM nucleophile showed efficient reactivity using different chiral ligands in the ... -lactone Scheme 1.11 Asymmetric Mannich reaction of -fluoro-β-ketoesters Fluorocarbon nucleophile are also excellent nucleophiles for Mannich reaction under chiral organic base catalysts Lu and ... asymmetric conjugated addition reactions Most aliphatic ketone and acetophenone nucleophiles used in organocatalytic asymmetric transformations rely on the formation of highly reactive enamine intermediates.1...
Ngày tải lên: 10/09/2015, 15:51
Chemistry of cyclopentadienylchromium complexes containing c , n and s organic ligands
... OC CO S8 or Se2 As OC CO OC Cr Cr CO OC CO P4 P Cr P P Cr OC CO CO OC Cr P P OC P Cr P P P P Cr P P Cr P OC CO Cr P P P P Cr P OC Cr CO OC P OC P Cr P CO Cr P P OC P P P P OC Cr P CO Cr CO OC ... S N Cr S Cr N N N N Cr C N N N C S S N N N N S N C N N (5)* (6) N H O BF4 N N (7) Cr C N Cr H O S N Cr C N C S N Cl (12) N N S (9)* Cr Cr Solv Cr N N (8)* Cl N C N N S Cr O N N MeOSO3 Cl Cl Cl ... OC OC Sb2S3 CO OC CO OC Cr S Sb Cr CO OC CO CO + Sb CO OC CO OC [CpCr(CO)2]2S CO 24 Cr 30 X P X X P P X X = S, Se Cr X P Cr OC P OC OC Cr OC CO CO P X P CO P OC OC + Cr OC Cr P Cr Cr CO OC CO...
Ngày tải lên: 03/10/2015, 20:33
Tài liệu Báo cáo khoa học: Binding of N- and C-terminal anti-prion protein antibodies generates distinct phenotypes of cellular prion proteins (PrPC) obtained from human, sheep, cattle and mouse doc
... chemiluminescence enhancement kit (Pierce, Bonn, Germany) Glycotyping of prion proteins In order to analyze the PrP glycoform patterns, proteins were scanned on a chemiluminescence photo-imager ... human PrPC were almost invisible and not detectable Heterogeneity of PrPC proteins is enhanced by endogenous proteolytic modifications, which occurs in vivo [25–27] PrPC from non-infected brains consists ... regulation of PrPC in consideration of the di-, mono- and nonglycosylated protein bands For distinct discrimination among various species, such as mouse, sheep, cattle and humans, C- terminal binding...
Ngày tải lên: 19/02/2014, 02:20
Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf
... muscle contraction [10] TnC interacts with both TnI and TnT The TnC–TnI interaction and changes in the interaction upon Ca2+ binding to TnC have been intensively studied as the central mechanisms ... the presence of TnC and the absence of Ca2+; lanes c and f, in the presence of both TnC and Ca2+ Ac, actin; Tm, tropomyosin; RTnC, rabbit TnC; ATnC, Akazara scallop TnC The relative staining intensities ... troponin, the activation is probably induced by strengthening of the interaction between the structural TnCbinding site and the C- domain of TnC accompanying Ca2+ binding to site IV of TnC In vertebrate...
Ngày tải lên: 20/02/2014, 01:20
The Project Gutenberg EBook of The Car of Destiny by C. N. Williamson and A. M. Williamson pot
... went on, and a new number, and any other little things that can be put on in a hurry And you'd better get a passport if you haven't one Gentlemen touring in foreign lands are sometimes subjected ... Hand Under the Curtains Behind an Iron Grating On the Road to Cadiz The Seven Men of Ecija The Race The Moon in the Wilderness Wiles and Enchantments Dreams and an Awakening ... went in again at night Meanwhile, Dick took steps to become correspondent for The Daily Despatch of London, and The New York Recorder, the editors of which papers he knew personally He spent...
Ngày tải lên: 07/03/2014, 11:20
Báo cáo khoa học: ` Inhibition of human ether a go-go potassium channels by 2+ Ca ⁄calmodulin binding to the cytosolic N- and C-termini potx
... with N- and C- terminal protein fragments of hEAG1 we could not detect interaction, neither alone nor in the presence of CaM (not shown) In addition, peptides encoding the N- and C- terminal binding ... activation and km the corresponding slope factor G is the maximal conductance of all channels and Erev the reversal potential Functional expression of hEAG1 channels Acknowledgements Capped mRNA was ... Xenopus oocytes The channel-inhibiting potency of wildtype hCaM and the EF-hand mutants were assayed in inside-out patches under repetitive channel activation at +50 mV in solutions containing...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: Amino acids at the N- and C-termini of human glutamate carboxypeptidase II are required for enzymatic activity and proper folding pptx
... ATTCTCGAGTCATTAGGCTACTTCACTCAAAG ACACTCGAGAGATCTGCAAATGAATATG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAACTCGAGAGATCTAAATCCTCCAATGAAGC CACCTCGAGTTATTATAGCTCAAACACCATCC AAACTCGAGAGATCTAAATCCTCCAATGAAGC CACCTCGAGTTATTATAGCTCAAACACCATCC ... ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTTTTCAGCTTGCAAAGCAA ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTAAGACTCATCCCAACTAC ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTGGATATGAAAATGTTTCGG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG ... sequences and thermal cycling parameters Variant Primer pairs (5¢ fi 3¢) 1–750 AAAGGTACCAAAGATGTGGAATCTCCTTCACG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAACTCGAGAGATCTAAATCCTCCAATGAAGC ATTCTCGAGTCATTAGGCTACTTCACTCAAAG...
Ngày tải lên: 07/03/2014, 15:20
Lecture notes on c algebras and quantum mechanics [jnl article] n lamdsman
... assumption of non-degeneracy guarantees that p is nonzero, and the conclusion implies that A ! p (A) de nes a subrepresentation of A on pH This subrepresentation is clearly cyclic, with cyclic vector ... the possible, Murray and von Neumann de ne a projection to be nite when it is not equivalent to any of its (proper) sub-projections an in nite projection is then a projection which has proper ... space X which is locally compact (in that each point has a compact neighbourhood) The space C0 (X ) consists of all continuous functions on X which vanish at in nity in the sense that for each...
Ngày tải lên: 17/03/2014, 14:41
Báo cáo khoa học: The starch-binding capacity of the noncatalytic SBD2 region and the interaction between the N- and C-terminal domains are involved in the modulation of the activity of starch synthase III fromArabidopsis thaliana pdf
... AAACATATGCTATATTACAATAAAA GG; 2.2up, AAACATATGTTATCTATCGTTGTAAAGC; 2.3up, AAACATATGCTTGTTCCTCAAAAACTTCC; 3.3rv, AAACTCGAGGACCTTAGCCGTAGTCTTCAC; 3.2rv, AAACTCGAGTTTTCCATTCAAAACCGTG Construction of ... of any protein band, indicating that the interaction is speci c Controls using pre-immune serum were consistently negative (not shown) Furthermore, the interaction between D123 and CD was confirmed ... possible protein–protein interactions and their effect on enzyme kinetics, we performed pull-down, far western blotting and co-expression experiments between the N- and C- terminal domains of SSIII In...
Ngày tải lên: 22/03/2014, 21:20
Báo cáo khoa học: Stabilities and activities of the N- and C-domains of FKBP22 from a psychrotrophic bacterium overproduced in Escherichia coli pptx
... contain it Overproduction and purification Upon induction for overproduction at 10 C, N- domain+ and C- domain+ accumulated in the cells in a soluble form, whereas C- domain– accumulated in the cells ... unfold in a complex non-two-state mechanism with two peaks apparent in the DSC curve Construction of the N- domain+ and C- domain+, which lack the C- and N- domains, respectively, followed by DSC analyses, ... PCR primers were 5¢-GACTCTGAGCTCGTAATCTAGT CACGCTTA-3¢ for N- domain+, where underlined bases show the position of the SacI site, and 5¢- GGCCACT GGATCCAACTACAGCAATTCTCA-3¢ for C- domain– and C- domain+,...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: Characterization of novel sequence motifs within N- and C-terminal extensions of p26, a small heat shock protein from Artemia franciscana potx
... 5¢-GGCACTTAACCCATGGTACATGGACCTTGATATTGAC-3¢ 5¢-GTCAATATCAAGGTCCATGTACCATGGGTTAAGTGCC-3¢ 5¢-GGACCTTGATATTGACGGTCCAGATACC-3¢ 5¢-GGTATCTGGACCGTCAATATCAAGGTCC-3¢ 5¢-GGATTGAAGGGGGAAGATCAGGAGGTGC-3¢ 5¢-GCACCTCCTGATCTTCCCCCTTCAATCC-3¢ ... Lightning Enhanced Chemiluminescence Reagent Plus (PerkinElmer Life Sciences, Boston, MA, USA) p2 6 synthesis in mammalian cells COS-1 cells were transiently transfected with p2 6-containing plasmids ... PCR DNA and Gel Band purification kit (Amersham Biosciences, Piscataway, NJ, USA) before cloning in the eukaryotic expression vector pcDNA4 ⁄ TO ⁄ myc-His.A (Invitrogen, San Diego, CA, USA) and...
Ngày tải lên: 30/03/2014, 20:20
Báo cáo khoa học: Comparative analysis of the site-specific N-glycosylation of human lactoferrin produced in maize and tobacco plants pdf
... terminal GlcNAc than the corresponding structures isolated from mLf Significant amounts of compounds (GlcNAc1XylFucMan3GlcNAc2) and (GlcNAc2XylFucMan3GlcNAc2) were identified in the tLf spectrum, ... sulphuric acid solution Enzymatic deglycosylation of glycopeptides Isolation of hLf cDNA and vector construction hLf cDNA was according to Salmon et al [21], and expression vectors containing ... therapeutic glycoproteins of mammalian origin in transgenic plants, and efforts are underway to obtain the in planta conversion of N- glycans to a human-compatible type Recently, tobacco cells transformed...
Ngày tải lên: 31/03/2014, 07:20
Báo cáo khoa học: Role of the N- and C-terminal regions of the PufX protein in the structural organization of the photosynthetic core complex of Rhodobacter sphaeroides pptx
... transport and photophosphorylation by incorporation of the reaction center, cytochrome bc1 complex and ATP synthase from Rhodobacter capsulatus into ubiquinone-10/phospholipid vescicles Biochim Biophys ... a continuous line connecting the points sampled by the recording apparatus; the best-fitting mono-exponential function is indicated by a continuous curve (A) ICM from strain PufXD2-26; (B) ICM ... PufX54* PufX68* PufX72* PufX76* PufX81* PufDX Yes Yes Yes Yes No Yes No No No Yes No 0.7 1.1 0.5 3.8 5.3 1.2 10.7 6.3 4.7 0.7 8.8 PMC3, PMC4 PMC3, PMC4 PMC3 (PMC4 )c PMC3 PMC3 PMC3, PMC3/4 PMC3...
Ngày tải lên: 31/03/2014, 09:20
SOLVABILITY CONDITIONS FOR SOME DIFFERENCE OPERATORS N. C. APREUTESEI AND V. A. VOLPERT Received 24 docx
... its index is zero In Section we prove that under some conditions on the polynomials P + and P − corresponding to operator L in (1.1), the bounded solutions of the equation Lu = are exponentially ... is closed To this, let { f n } be a sequence in ImL such that f n → f and let {un } be a sequence with the property Lun = f n Suppose in the beginning that {un } is bounded in E We construct ... construct a convergent subsequence Since un = sup j ∈Z |un | ≤ c, then for every positive integer N, there exists a j subsequence {unk } of {un } and an element u = {u j }N= N ∈ E such that j sup N ≤...
Ngày tải lên: 23/06/2014, 00:20
EXPONENTIAL STABILITY OF DYNAMIC EQUATIONS ON TIME SCALES ALLAN C. PETERSON AND YOUSSEF N. RAFFOUL pdf
... ¸ Chains, Mathematics and Its Applications, vol 370, Kluwer Academic Publishers, Dordrecht, 1996 A C Peterson and C C Tisdell, Boundedness and uniqueness of solutions to dynamic equations on ... This concludes the proof We now provide a special case of Theorem 3.4 for certain functions φ and ψ Theorem 3.5 Assume that D ⊂ Rn contains the origin and there exists a type I Lyapunov function ... still depends on t (and x of course) when the graininess function of ˙ T is nonconstant Several formulas are given in Peterson and Tisdell [7] for V (t,x) for various type I Lyapunov functions V...
Ngày tải lên: 23/06/2014, 00:20