c n and eb no io

... (b) TCNS15 TCNS10 TCNS5 TCNS3 TCNS1 TCNS0 Absorbance (a.u) Absorbance (a.u) TCNS15 TCNS10 TCNS5 TCNS3 TCNS1 TCNS0 800 Wavelength ( nm ) 1.6 1.8 2.0 2.2 2.4 2.6 2.8 3.0 3.2 3.4 3.6 3.8 4.0 Bandgap ... loading (TCNS5) and further increase results an activity decrease gradually Table BET surface area and particle size of the TCNS catalysts Catalyst TCNS0 TCNS1 TCNS3 TCNS5 TCNS10 TCNS15 Particle ... The band around 1730 cm-1 is attributed to carbonyl group and bands at 1130, 1040 cm-1 are corresponding to nitrite and hyponitrite groups present in TCNS5 and they are absent in TCNS0 which shows...

Ngày tải lên: 26/03/2014, 00:20

... deprotonation/deuteriation process 2.2 Enantioselective H/D exchange of -fluorinated aromatic ketones 2.2.1 Synthesis of -fluorinated aromatic cyclic ketones and chiral bicyclic guanidine catalyst ... Enantioselective H/D exchange reaction 2.1 Introduction Hydrogen/deuterium (H/D) exchange between organic compounds and deuterium sources is very important for a wide range of applications such ... the chiral bicyclic guanidine catalyst 25 The deuterium incorporation was monitored by H NMR and enantioselectivity was checked by chiral HPLC The initial experiment was carried out in THF in the...

Ngày tải lên: 10/09/2015, 15:51

... Enatioselective C- N bond formation 3.1 Introduction The catalytic, enantioselective, direct C- N bond formation reaction using carbonyl compounds and nitrogen sources, such as azodicarboxylates, ... Modification of racemic amination products Scheme 3.12 Deprotection of the N- carbamate under acidic conditions: a) HCl (g) in dioxane, oC; b) concd HCl, rt; c) 10% TFA, DCM, 0oC; d) TsOH, THF, oC ... CO2 NH3 118 N O OBn 117 unstable decomposition products Scheme 3.11 Dehydrofluorination of 109 under neutral conditions In considering unfavorable acidic conditions, they tried neutral conditions...

Ngày tải lên: 10/09/2015, 15:51

... Enatioselective C- C bond formation 4.1 Introduction Asymmetric C- C bond formation reactions are important reactions in organic synthesis Among the various asymmetric organic reaction, asymmetric ... reaction for the solvent screening We found that chlorinated solvents such as DCM and DCE resulted in much better conversion and excellent enantio- and diastereoselectivities (Table 4.6 entries ... reaction conditions The reaction did not show any enantioselectivity in presence of pentanidine 163e although the best diastereoselectivity 1/9 was obtained Table 4.2 Asymmetric Mannich reaction...

Ngày tải lên: 10/09/2015, 15:51

... from Na/benzophenone MeCN and CHCl3 were distilled from CaH2 MeOH was distilled from Mg 5.2 Preparation and Characterization of Substrates and catalysts 5.2.1 Preparation and characterization of ... 124.3 min; minor isomer: 132.8 5.4 Protocol for bicyclic guanidine catalyzed asymmetric C- N bond formation reaction and characterization of products 2-Fluoro-3,4-dihydronaphthalen-1(2H)-one 82d ... 121 Experimental Colorless oil LRMS (ESI) m/z 551.3 (M+Na+); 5.5 Protocol for bicyclic guanidine catalyzed asymmetric C- C bond formation reactions and characterization of products Procedures for...

Ngày tải lên: 10/09/2015, 15:51

... asymmetric conjugated addition reactions Most aliphatic ketone and acetophenone nucleophiles used in organocatalytic asymmetric transformations rely on the formation of highly reactive enamine intermediates.1 ... ee (minor) R3NH+ "inversion" R3NH+ Ar o FNSM R 3N S-FNSM QD-1, 10 mol% O S O R 3N F NO2 F NO2 H R-FNSM R-FNSM anion Scheme 1.17 Enantioselective Michael addition of FNSM to chalcones Based on Shibata ... basic phase-transfer conditions We will describe the asymmetric H/D exchange reaction, C- N and C- C bonds formation reactions catalyzed by our guanidine catalysts in the following chapters 23 Introduction...

Ngày tải lên: 10/09/2015, 15:51

... S N Cr S Cr N N N N Cr C N N N C S S N N N N S N C N N (5)* (6) N H O BF4 N N (7) Cr C N Cr H O S N Cr C N C S N Cl (12) N N S (9)* Cr Cr Solv Cr N N (8)* Cl N C N N S Cr O N N MeOSO3 Cl Cl Cl ... C N N R N N R N (No X-ray Structure) η1 -N 50 R N N C N N N N C N N N M SnR3 R = Et, Bu µ-η1,η1 (N, N’) 51 R R N N M C OC N N OC M CO CO N N Mn Mn CO N N N 10 N N OC C N N N N N C C R R R = CF3 ... Tetrazole complexes Scheme 1.3.9 N N N N CF3 N N CF3 N + + Na BrMn(CO)5 N Mn OC OC CO CF3 C N N CO OC O C N N OC Mn Mn + THF Mn(CO)3 CO OC N N N N - THF N N N N C C CF3 CF3 The reactivity of some...

Ngày tải lên: 03/10/2015, 20:33

... động Đ n năm 2002 tổng số c n c ng nh n vi n c ng ty 630 người đó: -N 190 người -Nam 440 người Trình độ c n c ng nh n vi n c ng ty từ trung c p trở n n c 150 người c trinhf độ đại h c Đ c điểm ... nghĩa n , nh n th c chất lượng tầm quan trọng vi c tạo s n phẩm c chất lượng cao phù hợp với nhu c u khách hàng c i thi n Nh n vi n c ng ty tiếp c n với nhiều ki n th c công c thống kê qu n ... kinh doanh Một số c n c ng nh n vi n c nh n th c sai lầm iso họ chưa tích c c tham gia vào vi c xây dựng áp dụng Nhiều người n n nóng vi c xây dựng hệ thống cho vi c t n C động chưa iso, coi...

Ngày tải lên: 28/09/2012, 11:52

... doanh nhiệm vụ giao ph n, phòng ban; vào bảng tiêu chu n l c c n c ng nh n vi n mà ph n x c định nhu c u cung c p lao động C c ph n phòng ban c ng ty lập nhu c u cung c p lao động vào biểu mẫu chuy n ... ngu n nh n l c bổ sung lao động, n ng cao chất lượng lao động c ng ty Kế hoạch tuy n dụng dựa vào kế hoạch cung c p ngu n nh n l c, vào phiếu đánh giá c n c ng nh n vi n năm Phòng TCHC ti n hành lập ... đươ c xa c định bằng mư c tiê n c ng theo c ́p độ c ng viê c của c ng nh n chia cho mư c sa n lượng Với mỗi loại c ng viê c công ty quy định mư c sa n lượng kha c đươ c tính thành c ng,...

Ngày tải lên: 17/07/2013, 11:11

... ̣t c ̉a sổ hi n yêu c ̀ u ba n xa c nhâ n lầ n nữa có thư c sự muố n tiế n hành thay đổ i hay không, ba n nhấ n ̣ vào Apply Changes c ̉a sổ này Cuố i cùng, hô ̣p thoa ̣i hi n ... di n của chương trình, ba n cho n tab Largest MTU, điề n điạ chỉ trang web c ̀ n kiể m tra và ̣ nhấ n Start Ba n n n kiể m tra trươ c và sau tiế n hành ca c thay đổ i để có ... sánh và đố i chiế u ca c kế t quả Tuy nhi n, không hẳ n kế t quả cung c ́ p bởi chương trình đã là chính xa c Chương trinh có thể sử du ̣ng đố i với kế t n ́ i DSL, cáp quang...

Ngày tải lên: 02/08/2013, 01:27

... region (N- terminal region) Intermediary region (N- terminal region) Intermediary region (N- terminal region) Central region (C- terminal region) Central region (C- terminal region) Central region (C- terminal ... disulphide bond between cysteine residues [18] The role of PrPC in cell function is not known, but it has been associated with synaptic, enzymatic and signaling functions, copper binding and transport ... of PrPC in consideration of the di-, mono- and nonglycosylated protein bands For distinct discrimination among various species, such as mouse, sheep, cattle and humans, C- terminal binding antibodies...

Ngày tải lên: 19/02/2014, 02:20

... muscle contraction [10] TnC interacts with both TnI and TnT The TnC–TnI interaction and changes in the interaction upon Ca2+ binding to TnC have been intensively studied as the central mechanisms ... (5¢-GAGCATGGCGGGAT CCTACATGCGCAC-3¢) and RTnI96F (5¢-GCTGGAGG CCATGGACCAGAAGC-3¢) and RTnI181R, respectively (BamHI ⁄ NcoI sites and termination ⁄ initiation codons are indicated by underlines and bold ... TAGC-3¢), ATnI1F and ATnI128R (5¢-GTTCCGGATC CTATCTTCTGGCTTCC-3¢), ATnI130F (5¢-GCCAGAA CCATGGCGGAGGAAC-3¢) and ATnI292R, ATnI130F and ATnI252R (5¢-CAAGTTTGGGATCCTATTTGTTAA CTTTTC-3¢), and ATnI232F...

Ngày tải lên: 20/02/2014, 01:20

... Hand Under the Curtains Behind an Iron Grating On the Road to Cadiz The Seven Men of Ecija The Race The Moon in the Wilderness Wiles and Enchantments Dreams and an Awakening ... hardly accept such an invitation if she didn't intend something to come of it.” “You're certain the invitation's been accepted?” “Certain Angèle de la Mole has been with her brother in Spain, and ... Vale-Avon's inherited and most treasured possessions, an interesting pearl head-dress of the conventional Juliet fashion This had been sent for from England; and if I could succeed in getting to...

Ngày tải lên: 07/03/2014, 11:20

... with N- and C- terminal protein fragments of hEAG1 we could not detect interaction, neither alone nor in the presence of CaM (not shown) In addition, peptides encoding the N- and C- terminal binding ... In terms of Ca2+ regulation, hEAG1 channels are readily inhibited by Ca2+ ⁄ CaM at low Ca2+ concentrations [6] and low CaM concentrations (Fig 1) As for CNG channels, hEAG1 harbors CaM-binding ... either (n ¼ 4, not shown) Discussion Use of FCS measurements and peptide arrays for CaM binding site characterization B Fig Functional impact of mutations in the N- terminal CaM-binding site and in...

Ngày tải lên: 07/03/2014, 12:20

... ATTCTCGAGTCATTAGGCTACTTCACTCAAAG ACACTCGAGAGATCTGCAAATGAATATG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAACTCGAGAGATCTAAATCCTCCAATGAAGC CACCTCGAGTTATTATAGCTCAAACACCATCC AAACTCGAGAGATCTAAATCCTCCAATGAAGC CACCTCGAGTTATTATAGCTCAAACACCATCC ... ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTTTTCAGCTTGCAAAGCAA ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTAAGACTCATCCCAACTAC ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTGGATATGAAAATGTTTCGG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG ... ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAACTCGAGAGATCTAAATCCTCCAATGAAGC ATTCTCGAGTCATTATGCAACATAAATCTGTCTCTT AAACTCGAGAGATCTAAATCCTCCAATGAAGC AAACTCGAGTTATTATTCAATATCAAACAGAG AAAAGATCTAAAGCATTTTTGGATGAATTG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG...

Ngày tải lên: 07/03/2014, 15:20

... projections in the sense of Murray and von Neumann, and I is in nite The range of d is 1] 10 HISTORICAL NOTES type III: M has no minimal projections, all nonzero projections are in nite-dimensional ... representations Von Neumann's bicommutant theorem implies a useful alternative characterization of von Neumann algebras from now on we add to the de nition of a von Neumann algebra the condition that ... assumption of non-degeneracy guarantees that p is nonzero, and the conclusion implies that A ! p (A) de nes a subrepresentation of A on pH This subrepresentation is clearly cyclic, with cyclic vector...

Ngày tải lên: 17/03/2014, 14:41

... region did not prevent the positive interaction between D23 and CD, indicating that the D1 region does not have a significant contribution to the binding process Analysis of the interaction between ... AAACATATGCTATATTACAATAAAA GG; 2.2up, AAACATATGTTATCTATCGTTGTAAAGC; 2.3up, AAACATATGCTTGTTCCTCAAAAACTTCC; 3.3rv, AAACTCGAGGACCTTAGCCGTAGTCTTCAC; 3.2rv, AAACTCGAGTTTTCCATTCAAAACCGTG Construction of site directed ... regions and CD plays an important role in the promotion of starch SBD regulation of starch synthase III activity binding to CD, subsequently increasing its concentration in the active site, and...

Ngày tải lên: 22/03/2014, 21:20

... shown contains the entire a3 helix and the latter does not contain it Overproduction and purification Upon induction for overproduction at 10 C, N- domain+ and C- domain+ accumulated in the cells ... Structure and Functional Analyses and by a Grant-in-Aid for Scienti c Research (No 16041229) from the Ministry of Education, Culture, Sports, Science and Technology of Japan, and by a research grant ... proteins are composed of N- and C- domains, which are spanned by a 40 amino acid long a3 helix The N- domain consists of a1 and a2 helices and an N- terminal region of a3 helix The C- domain consists...

Ngày tải lên: 23/03/2014, 13:20

... missing p26 region Mutation Primer sequence N- terminal extension G 5¢-GGCACTTAACCCATGGTACATGGACCTTGATATTGAC-3¢ 5¢-GTCAATATCAAGGTCCATGTACCATGGGTTAAGTGCC-3¢ 5¢-GGACCTTGATATTGACGGTCCAGATACC-3¢ 5¢-GGTATCTGGACCGTCAATATCAAGGTCC-3¢ ... 5¢-GGTATCTGGACCGTCAATATCAAGGTCC-3¢ 5¢-GGATTGAAGGGGGAAGATCAGGAGGTGC-3¢ 5¢-GCACCTCCTGATCTTCCCCCTTCAATCC-3¢ R C- terminal extension TS XL1-blue supercompetent cells (Stratagene) p26 cDNA inserts were recovered ... p26 contains two novel N- terminal sequences, one enriched in glycine and the other in arginine Additionally, the C- terminus contains an unusual stretch of residues endowed with threonine and serine...

Ngày tải lên: 30/03/2014, 20:20

... sulphuric acid solution Enzymatic deglycosylation of glycopeptides Isolation of hLf cDNA and vector construction hLf cDNA was according to Salmon et al [21], and expression vectors containing the lactoferrin ... presence of at least one terminal GlcNAc [31] As the N- glycans identified in both plants contain both epitopes, the higher proportion of GlcNAccontaining glycans in tLf mainly reflects differences in ... mLf Significant amounts of compounds (GlcNAc1XylFucMan3GlcNAc2) and (GlcNAc2XylFucMan3GlcNAc2) were identified in the tLf spectrum, whereas these glycans were virtually absent in the spectrum of...

Ngày tải lên: 31/03/2014, 07:20