... immunocompetent mice infected with CVB3 [67,109] In the immunodeficient mice, the CVB3 infection led to chronic myocarditis characterized by marked cell infiltration to the myocardium, and necrosis ... when prostate cancer was induced in mice, revealing a remarkable increase in contact between the prostate carcinoma cells and the stromal cells, which is critical for prostate cancer progression ... pancreatic carcinoma cells [108] PDGF-B and several other growth factors have previously been shown to stimulate this desmoplastic reaction Investigations of surgically resected pancreatic cancerous...
Ngày tải lên: 19/02/2014, 07:20
... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... controls vacuolar and endocytic traf c through a prevacuolar compartment in Saccharomyces cerevisiae J Cell Biol 131, 603–617 Cereghino JL, Marcusson EG & Emr SD (1995) The cytoplasmic tail domain ... Vps4 C- terminal helix P R Vajjhala et al A B Fig Construction of Vps4p C- terminal mutants (A) Schematic representation of wild-type Vps4p (B) Alignment of C- terminal sequences of Saccharomyces cerevisiae...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Relation between domain evolution, specificity, and taxonomy of the a-amylase family members containing a C-terminal starch-binding domain pot
... Aspka Bacsp Crcsp Stral Strgr Strli21 Strli24 Strve Thscu Psesa Psest Psesp Bacst Actsp Bac11 Bac17 Bac38 Bac663 Bac1011 BacA2 Bac1018 BacE1 BacKC Bacbr Bacci8 Bacci251 BacciA Baccl Bacli BacmaIB7 ... Bacillus sp KC201 Bacillus brevis Bacillus circulans Bacillus circulans 251 Bacillus circulans A11 Bacillus clarkii Bacillus licheniformis Bacillus macerans IB7 Bacillus macerans IFO 3490 Bacillus ... Klebsiella pneumoniae Nostoc sp PCC 9229 Bacillus circulans strain 251 CGT Klebsiella pneumoniae CGT Nostoc sp PCC 9229 CGT Thermococcus sp B1001 CGT Actinoplanes sp SE50 ACT Bacillus stearothermophilus...
Ngày tải lên: 08/03/2014, 08:20
Class Members and Class Reuse
... public Counter(int count) public int GetCount() public void SetCount(int count) private int { { { { SetCount(0); } SetCount(count); } return count; } this.count = count; } count; } The class Counter ... on Constructor/Destructor Chaining Objects are built from the top down A constructor of a derived class calls a constructor of its base class, which in turn calls a constructor of its superclass, ... Console.Write("cR = {0} ", c. GetCount()); } static void IncV(Counter c) { c = new Counter(); c. Inc(); Console.Write("cV = {0} ", c. GetCount()); } static void Main() { string msg = "Hello!"; Console.Write("{0}...
Ngày tải lên: 05/10/2013, 05:20
Tài liệu UNIT 7: FAMILY MEMBERS
... .Mark(s): IV Circle the odd one out ( Hãy khoanh tròn từ kh c với ba từ lại) A How B What C Who A father B mother C brother A school B library C classroom A her B your C his D Peter D friend...
Ngày tải lên: 03/12/2013, 23:11
Bài soạn UNIT 7: FAMILY MEMBERS
... .Mark(s): IV Circle the odd one out ( Hãy khoanh tròn từ kh c với ba từ lại) A How B What C Who A father B mother C brother A school B library C classroom A her B your C his D Peter D friend...
Ngày tải lên: 03/12/2013, 23:11
Tài liệu Class, Structure, and Interface Members docx
... a call to a class's New subprocedure The equivalent call to the SqlCommand class constructor in VB is: Public Sub New( ) A.5.3 Properties The SqlCommand.CommandText property provides a typical ... C# methods that return void are expressed as subprocedures in VB Here's the corresponding syntax of the AcceptChanges method: Public Sub AcceptChanges( ) All C# methods other ... classes whose objects they instantiate and they don't indicate a return value For example, the default constructor for the SqlCommand class is: public SqlCommand( ); In VB, the constructor is represented...
Ngày tải lên: 14/12/2013, 18:16
Tài liệu Defining Members pptx
... the private and public keywords to indicate each member's access in a class: class State { private var statePopulation:Number; function State() { //Constructor } public function setPopulation(num:Number) ... differ for each instance There may be circumstances, however, when you need a property that is not only accessible by every instance of a class, but has a universal value across all instances This ... a class is duplicated within an instance whenever that instance is created Consider the State class example that we've used a few times in this lesson For every new instance of that class, a copy...
Ngày tải lên: 26/01/2014, 11:20
Tài liệu Báo cáo khoa học: Regulation of the members of the mammalian heat shock factor family doc
... spermatogenic process to succeed, correct cell type- and stage-speci c gene expression is a prerequisite, and is therefore strictly controlled at multiple levels [90] The significance of functional ... Promoter ChIP-chip analysis in mouse testis reveals Y chromosome occupancy by HSF2 Proc Natl Acad Sci U S A 105, 11224–11229 ˚ Sandqvist A, Bjork JK, Akerfelt M, Chitikova Z, Gri¨ chine A, Vourc’h C, ... Hazzalin CA & Mahadevan LC (2004) Distinct stimulus-speci c histone modifications at hsp70 chromatin targeted by the transcription factor heat shock factor-1 Mol Cell 15, 585–594 65 Clos J, Rabindran...
Ngày tải lên: 18/02/2014, 04:20
Tài liệu Báo cáo khoa học: Arabidopsis thaliana BTB⁄ POZ-MATH proteins interact with members of the ERF⁄AP2 transcription factor family ppt
... transcription factors, were amplified directly from Col0 genomic DNA In all cases, Pfu polymerase (Promega, Mannheim, Germany) was used and the PCR products were controlled for correct sequences The cDNAs ... RAP2.4 and CUL3A in Nicotiana benthamiana leaves was analyzed by confocal laser scanning microscopy GFP signals (green) and merged images of GFP against the red chlorophyll autofluorescence background ... protein–protein interaction motifs, such as KELCH or meprin and TRAF (tumor necrosis factor receptor-associated factor) homology (MATH) motifs, indicating involvement in various biological processes [5,10–13]...
Ngày tải lên: 18/02/2014, 06:20
Tài liệu Báo cáo khoa học: Final steps in the catabolism of nicotine Deamination versus demethylation of c-N-methylaminobutyrate doc
... GAT CCG TGG GCC GCA-3¢ 5¢-GAA TGA CTC GAG CCG AAG TAA TC-3¢ 5¢-CTT CTG AGG ATC CCA AAT GAC AGT-3¢ 5¢-CAT GTA AGC CCC CTC GAG TCG TTC AG-3¢ 5¢-CGT CAC GGT ATT CGA AGC C- 3¢ 5¢-CAC TGG CTA ATT CCA ... AGC C- 3¢ 5¢-CAC TGG CTA ATT CCA GTG C- 3¢ 5¢-CAC TAG CGA AGA TGC CGT C- 3¢ 5¢-CCA ACG CAG AAA CTC GGC-3¢ 5¢-CGG CAT TAT CGG TGA CAG C- 3¢ 5¢-CGC GCA ACA CTG AGG GAC-3¢ Forward Reverse Forward Reverse ... c- N-methylaminobutyrate catabolism catalyzed by AO In this reaction FAD is reduced to FADH2 The pAO1-encoded SsaDH then produces succinate, which enters the citric acid cycle, and NADPH A nicotinovorans...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo Y học: Divergent members of a soybean (Glycine max L.) 4-coumarate:coenzyme A ligase gene family potx
... 5¢-TBACNCARTCNGCNTAYGTBGARAA-3¢ 5¢-GTTCTAAGCTTTTAAGGCGTCTGAGTGGC-3¢ 5¢-AGTTTCAGGGTCAACAACCCTG-3¢ 5¢-CTCGAATTCATGACAACGGTAGCTGCTTCTC-3¢ 5¢-CTCGGATCCATGGCTGATGATGGAAGCAG-3¢ 5¢-TCAGCGTCACCGTTATCCTC-3¢ ... 5¢-GTGAGAAATGGAGATGCTGC-3¢ 5¢-TGTTCCGGAGAGCCTCCTC-3¢ 5¢-CAACGGAAGCACGCATAGGAGCAC-3¢ 5¢-CACCGCATGCATAACTCTAGCTCCTTCTCTTG-3¢ 5¢-GTAAAACGACGGCCAGT-3¢ Ó FEBS 2002 4-Coumarate:CoA ligase gene family from Glycine ... 4CL13-EcoRI 4CL14-BamHI 4CL14-GSP1 4CL14-GSP2 4CL16-GSP1 4CL16-GSP2 4CL16-SphI Seq1 5¢-GTTGCGTAGGACGAGCAT-3¢ 5¢-CGGATGCCGATTTTGTGGAGG-3¢ 5¢-GCTGGTACCGCACCTTCTCCACAAG-3¢ 5¢-TCYGGRTCRTTNAGRTADCCTTTCAT-3¢...
Ngày tải lên: 22/02/2014, 04:20
Professional ASP.NET 3.5 Security, Membership, and Role Management with C# and VB ppt
... System.Diagnostics Imports System.Web Namespace CustomTracingModule Public Class CustomTracing Implements IHttpModule ‘ Private member to hold a reference to the ‘ TraceSource class Private tsTracing As TraceSource ... additional and advanced settings can be set by right-clicking on the specific application pool and selecting Advanced Settings Classic Mode The Classic mode resembles an IIS 6.0 application pool when ... protocols and services that handle request processing inside IIS 7.0 Protocol Listeners Protocol listeners are services in which each service is configured to listen and process a specific protocol...
Ngày tải lên: 05/03/2014, 22:20
CLR via C#, 4th Edition pdf
... CLR compiles the IL into native CPU instructions Native code compilers produce code targeted to a specific CPU architecture, such as x86, x64, or ARM All CLR- compliant compilers produce IL code ... specifying the /CLR command-line switch, the C+ + compiler produces modules that contain managed code, and of course, the CLR must then be installed to execute this code Of all of the Microsoft compilers ... few non–CLS-compliant constructs causing the C# compiler to complain about the code using System; // Tell compiler to check for CLS compliance [assembly: CLSCompliant(true)] namespace SomeLibrary...
Ngày tải lên: 06/03/2014, 15:20
Báo cáo khoa học: Differential recognition of heat shock elements by members of the heat shock transcription factor family ppt
... oligonucleotide (TCGACACCCCTTATCTAGAGACCCCTTACCTCGA) was used as a nonspeci c binding control Samples were subjected to gel electrophoresis and phosphorimaging Open and closed arrowheads indicate ... pGL3-Basic vector (Promega) to create CRYGA–LUC, CRYGB–LUC, CRYGC–LUC, and CRYGD–LUC, respectively In vitro polypeptide synthesis, electrophoretic mobility shift assay, and chemical crosslinking ... hHSF4–VP16 cotransfection In electrophoretic mobility shift assays, DNA fragments containing the CRYGA and CRYGB HSEs were bound by hHSF1 and hHSF4–VP16 (Fig 5B) The cC-crystallin (CRYGC) promoter contains...
Ngày tải lên: 07/03/2014, 00:20
Professional ASP.NET 3.5 Security, Membership, and Role Management with C# and VB docx
... System.Diagnostics Imports System.Web Namespace CustomTracingModule Public Class CustomTracing Implements IHttpModule ‘ Private member to hold a reference to the ‘ TraceSource class Private tsTracing As TraceSource ... additional and advanced settings can be set by right-clicking on the specific application pool and selecting Advanced Settings Classic Mode The Classic mode resembles an IIS 6.0 application pool when ... protocols and services that handle request processing inside IIS 7.0 Protocol Listeners Protocol listeners are services in which each service is configured to listen and process a specific protocol...
Ngày tải lên: 15/03/2014, 02:20
2011 Annual Report TO MEMBERS pptx
... both IDC and ICI continued to include risk management topics in their conferences IDC’s 2010 fall conference included panel sessions on risk and IDC hosted two educational conference calls on ... ICI members can also contribute directly to a member of Congress on the 44 2011 ANNUAL REPORT TO MEMBERS To find out more about the Chairman’s Council and ICI PAC, please contact ICI’s Political ... www.ici.org/policy#financial_markets 2011 ANNUAL REPORT TO MEMBERS 43 ICI’s Political Program: The Chairman’s Council In bipartisan fashion, ICI’s political program, the Chairman’s Chairman’s Council...
Ngày tải lên: 16/03/2014, 14:21