c m grieve little magazines and the movement for renewal
C#1 introduction to programming and the c language potx
Ngày tải lên :
18/03/2014, 02:20
... commands his document is called the programs code or source code he individual commands must be written in a very precise way, that the computer can understand them, and it is here a programming ... document with commands Commands are also called statements Because these commands or statements are just text, the machine can not immediately execute the commands, but they must irst be translated ... the class has only one method called Main(), which is the method called when the program starts A method consists of statements that can be perceived as commands that are performed on the machine...
- 30
- 538
- 0
Tài liệu Security Essentials Day 2 Threat and the Need for Defense in Depth docx
Ngày tải lên :
09/12/2013, 17:15
... vulnerabilities, and when a threat is able to connect to its specific vulnerability, the result can easily be system compromise Again, the most common tactic is to protect systems with perimeter devices such ... be something executable, such as exe, com, or bat The attached file contains both the malicious code decoy file copied from the sending infected system This attack actually has elements of confidentiality, ... of these turned out to be private for proprietary information Additional information about SirCam can be found here: http://www.symantec.com/avcenter/venc/data/w32.sircam.worm@mm.html On the...
- 31
- 572
- 0
Tài liệu The international community and the “NTP for coping with CC” pdf
Ngày tải lên :
24/01/2014, 00:20
... framework to achieve both policy aims • Stress the importance of and potential for synergies between economic development, vulnerability reduction and GHG reduction in the medium and long term, ... and the wider public • Refine the CCA strategy • Adopt CC impact scenarios as the basis for public and private investments • Mainstream reduction of CC-related vulnerabilities in (national, local, ... (public sector), and cleaner production (business sector) • There is a huge need for incentives for and co-funding from the business sector to increase energy efficiencies, adoption and development...
- 11
- 364
- 0
Tài liệu The Elegant Universe: Superstrings, Hidden Dimensions, and the Quest for the Ultimate Theory docx
Ngày tải lên :
25/01/2014, 16:20
... touch of a human hand Microscopically, the electric charge of a particle plays the same role for the electromagnetic force as mass does for gravity: it determines how strongly the particle can ... saddle (c) has a longer circumference, even though they all have the same in a small decrease in the circle's radius circumference The circumference of the circle in (c) , again drawn on a curved ... those comrades who cannot contribute the common amount of money they each owe the landlord because the monetary denomination they carry is too large, if the minimum energy a particular wave can carry...
- 189
- 480
- 0
Tài liệu the supply oF money – banK behaViour and the implications For monetary analysis doc
Ngày tải lên :
16/02/2014, 11:20
... rates and accommodating the demand for outside money Changes in these interest rates alter the opportunity costs of money holdings and thereby affect the demand for broad money however, monetary ... area M3 multiplier this point, a decomposition of the change in Japan M2 multiplier US M2 mutliplier the M3 money multiplier in the euro area can 14 14 be calculated The M3 money multiplier can ... to the m3 deposit facility) Changes in the M3 money multiplier in the euro area multiplier (MM) can therefore be decomposed into the contribution due to changes in the (annual percentage changes;...
- 17
- 519
- 0
THE FACTORS AFFECTING THE USE OF ELDERLY CARE AND THE NEED FOR RESOURCES BY 2030 IN FINLAND pot
Ngày tải lên :
14/03/2014, 17:20
... service data) into the form, where resource needed of each service and care form were computable in EVERGREEN 2000 -model The model calculates for each service the number of users conditional on the ... from public sources the detailed (and comparable) figures of the commission, but at least in home help services and home nursing the commission assumes that 7500 more (not including replacements) ... For the rest of the services binomial logistic model is used to model whether the individual is a service recipients or not For the mathematical and stochastic specification of the models, see Appendix...
- 56
- 625
- 0
The challenge of obesity in the WHO European Region and the strategies for response pptx
Ngày tải lên :
16/03/2014, 14:20
... area stretching from the Arctic Ocean in the north and the Mediterranean Sea in the south and from the Atlantic Ocean in the west to the Pacific Ocean in the east The European programme of WHO ... (44,45) In most countries in the Region, obesity is more common among socially deprived communities, characterized by lower income, education and access to care However, in some countries – such as ... outlets A recent WHO forum and technical meeting (76) reviewed the area of marketing food and non-alcoholic beverages to children and concluded that the commercial promotion of energy-dense micronutrient-poor...
- 76
- 485
- 0
The Heart of Grief Death and the Search for Lasting Love pptx
Ngày tải lên :
22/03/2014, 18:20
... Simon Music Printed in the United States of America on acid free paper In loving memory of my father, Clare Attig, and my grandmother, Mary Nagel, and in gratitude for all they have given and continue ... relationships The familiar John Denver song "Perhaps Love" captures their sometimes placid, sometimes stormy, sometimes joyful, sometimes painful, sometimes enriching, and sometimes challenging character ... Incomplete and Partial Memories 142 Richly Meaningful Memories 147 The Dance Continues in Memory 153 IV PRACTICAL LIFE They Are with Us in Our Practical Lives 161 Acting on Promises 167 UsingTheirAdvice...
- 310
- 871
- 0
leaving earth space stations, rival superpowers and the quest for interplanetary travel
Ngày tải lên :
03/06/2014, 01:55
... packed up and climbed into the descent module of Soyuz Then, at 11:28 P .M Moscow time, they undocked from the Salyut station, and quickly eased away from what had been their home in space for the ... the capcom (or “capsule communicator,” the person in charge of radio communications with the crew) asked why Dobrovolsky hadn’t used the station’s special electric razor, attached to a vacuum ... mission seemed nothing more than an empty stunt that accomplished little *Every Soviet/Russian space mission commander chose a code name for his mission For Soyuz 11’s crew, the code name was Yantar,...
- 537
- 337
- 0
signature in the cell dna and the evidence for intelligent design
Ngày tải lên :
08/06/2014, 09:00
... GGCAAGATCGTCGGCAACAAGTGGGAGGCTTACCTGGGGCTGCTGCAGGC CGAGTACACCGAGGGGTGAGGCGCGGGCCGGGGCTAGGGGCTGAGTCCGC CGTGGGGCGCGGGCCGGGGCTGGGGGCTGAGTCCGCCCTGGGGTGCGCGC CGGGGCGGGAGGCGCAGCGCTGCCTGAGGCCAGCGCCCCATGAGCAGCT TCAGGCCCGGCTTCTCCAGCCCCGCTCTGTGATCTGCTTTCGGGAGAACC ... evolutionary account of biological origins? The Origin of Biological Information Consider the following sequence of letters: AGTCTGGGACGCGCCGCCGCCATGATCATCCCTGTACGCTGCTTCACTTGT GGCAAGATCGTCGGCAACAAGTGGGAGGCTTACCTGGGGCTGCTGCAGGC ... Strings of precisely sequenced chemicals called nucleotide bases store and transmit the assembly instructions the information for building the crucial protein molecules and machines the cell needs...
- 458
- 306
- 0
university press of kentucky peace out of reach middle eastern travels and the search for reconciliation jun 2007
Ngày tải lên :
11/06/2014, 12:44
... varieties—some believe in their religion, some in their nation, some in their ethnic community—but they share much in common What marks them all is a lack of concern for the “other,” a conviction that their ... is equally informed by my academic research and activism Originally, my scholarly concerns revolved around the European labor movement, fascism, anti-Semitism, and Western political theory beginning ... General Tommy Franks.10 At the time, the former was the chair of the Senate Select Intelligence Committee, and the latter was the head of U.S Central Command Franks apparently told Graham, “we are...
- 208
- 760
- 0
university of minnesota press revolution televised prime time and the struggle for black power oct 2004
Ngày tải lên :
11/06/2014, 13:07
... Philadelphia, the Regal in Chicago, and other black theaters made up the Chitlin’ Circuit and became important settings for African American performers and audiences On northern doorsteps, members of the ... exert their energies and placate the new administration: the civil rights movement these actualities brought home the necessity for, and intensity of, the black social movement. 16 These comments ... into mainstream white American society, African Americans needed to emulate white America This involved showing America how well the African American could mimic white cultural forms Their embarrassment...
- 256
- 421
- 0
Báo cáo khao học: "The heritability of wood density components in Pinus pinaster Ait. and the implications for tree breeding" ppt
Ngày tải lên :
08/08/2014, 14:20
... respectively mean –3 RD (g cm ) –3 MND (g cm ) –3 MXD (g cm ) –3 EWD (g cm ) –3 LWD (g cm ) LWP (%) RW (mm) –3 HI (g cm ) heritability (h i), additive genetic variance (VA), and total phenotypic ... to 12% moisture content These radial samples were X-rayed and their image scanned by microdensitometric analysis in order to determine the density components according to the process described ... Vargas-Hernandez and Adams [41] and Zhang and Morgenstern [48] estimated an h2i = 0.60 value for RD for Pseudotsuga menziesii and Picea mariana, respectively Another important aspect is the fact that the...
- 7
- 266
- 0
Báo cáo y học: "Postictal psychosis: presymptomatic risk factors and the need for further investigation of genetics and pharmacotherapy" doc
Ngày tải lên :
08/08/2014, 21:20
... hippocampus in schizophrenia Hippocampus 2001, 11(5):520-528 McGuire PK, Bates JF, Goldman-Rakic PS: Interhemispheric integration: I Symmetry and convergence of the corticocortical connections ... free of charge to the entire biomedical community peer reviewed and published immediately upon acceptance cited in PubMed and archived on PubMed Central yours — you keep the copyright BioMedcentral ... Crossed corticothalamic and thalamocortical connections of macaque prefrontal cortex J Comp Neurol 1987, 257(2):269-281 Monji A, Yanagimoto K, Maekawa T, Sumida Y, Yamazaki K, Kojima K: Plasma folate...
- 6
- 514
- 0
Báo cáo y học: " Factors that may mediate the relationship between physical activity and the risk for developing knee osteoarthritis" pot
Ngày tải lên :
09/08/2014, 10:22
... structures and the implementation of objective and accurate assessments of physical activity may also enhance our understanding of the mechanism by which physical activity affects the knee joint ... between excess body mass and joint abnormalities, such as the reduction in cartilage volume and the presence of cartilage defects [24-26] Physical activity may therefore represent a management strategy ... http://arthritis-research.com/content/10/1/203 These studies indicate the importance of muscle mass in protecting the structures of the knee joint and the need for longitudinal studies to account for this factor when...
- 10
- 310
- 0
báo cáo khoa học: " Balancing intellectual monopoly privileges and the need for essential medicines" potx
Ngày tải lên :
11/08/2014, 18:20
... sets forth global minimum standards for protecting and enforcing all forms of IPRs (or IMPs), including those for pharmaceuticals The agreement contains a number of requirements that WTO member countries ... prices to consumers by creating competition in the market for the patented product As many developing countries lack the domestic capacity or technical expertise to manufacture patented pharmaceuticals, ... free of charge to the entire biomedical community peer reviewed and published immediately upon acceptance cited in PubMed and archived on PubMed Central yours — you keep the copyright BioMedcentral...
- 5
- 208
- 0
báo cáo khoa học:" Challenges in comparing the quality of life of older people between ethnic groups, and the implications for national well-being indicators: a secondary analysis of two cross-sectional surveys" ppsx
Ngày tải lên :
11/08/2014, 23:22
... participants (almost all of whom rate all the topics as important) and the others, though the Chinese participants returned significantly higher importance in some topics Adjusting for the covariates ... optimum summary score for that group Table 1: Linear regression coefficients (Region and ethnicity had significant interactions predicting OPQOL and CASP Importance of leisure aspects and ethnicity ... weighting (for each combination of ethnic group and region) Assumptions were examined graphically An assumption about including mixed race British-Caribbean numbers from the 2001 UK Census within the...
- 15
- 257
- 0
Báo cáo y học: "Hyperuricemia and the risk for subclinical coronary atherosclerosis - data from a prospective observational cohort study" potx
Ngày tải lên :
12/08/2014, 15:23
... scientific statement from the American Heart Association Committee on Cardiovascular Imaging and Intervention, Council on Cardiovascular Radiology and Intervention, and Committee on Cardiac Imaging, ... (Imatron C- 150™; GE Medical Systems, Milwaukee, WI [Chicago and Oakland centers]) or a multidetector CT scanner (GE Lightspeed™; GE Medical Systems [Birmingham center] or Volume Zoom™; Siemens, ... Cardiovascular Radiology and Intervention; American Heart Association Committee on Cardiac Imaging, Council on Clinical Cardiology: Assessment of coronary artery disease by cardiac computed tomography:...
- 8
- 350
- 0
public private partnerships and the prospects for sustainable ict projects in the developing world
Ngày tải lên :
21/08/2014, 15:25
... from low-cost projects, when these are successful The enthusiasm and commitment of decision-makers is a common factor in most successful cases, and the presence of a local project champion can ... ultimately increase over time Successful Outcomes for the Cases It may be too soon to comment on the long-term outcomes of the above cases in terms of economic and social benefits for the communities ... planning and communication, leading to economic growth If governments allow, local communities can become their own telecommunications providers, not reliant upon the central administration for handouts...
- 16
- 281
- 0
three essays exploring consumers' relationships with brands and the implications for brand equity
Ngày tải lên :
02/11/2014, 00:49
... equity, managerial capabilities influence the success of strategic and tactical decisions such as market definition, which affects the scope of the brand (i.e., mass vs niche), and myriad other tactics ... franchise such as the Chicago Cubs At the end of the season, all information about the team is known, including both individual and team statistics for the Cubs and for all other teams in the ... Chapter came from the Procter and Gamble Company through the generous efforts of Andreas Onnen and John Myers; I am grateful for their insights and guidance during the development and implementation...
- 186
- 255
- 0