c is a strongly typed language
Tài liệu Replacing Null Values in a Strongly Typed DataSet ppt
Ngày tải lên :
14/12/2013, 18:16
... // Create the DataAdapter SqlDataAdapter da = new SqlDataAdapter("SELECT * FROM Categories", ConfigurationSettings.AppSettings["Sql_ConnectString"]); if (annotatedRadioButton.Checked) { // Create ... demonstrate the effect of the schema annotation on null column values The C# code is shown in Example 2-26 Example 2-26 File: TypedDataSetNullsForm.cs // Namespaces, variables, and constants using System; ... the typed DataSet without null annotation CategoriesDS_AnnotatedNull ds = new CategoriesDS_AnnotatedNull( ); // Fill the Categories table within DataSet da.Fill(ds, CATEGORIES_TABLE); // Add a...
- 4
- 339
- 0
Tài liệu Modifying Data Using a Strongly Typed DataSet pptx
Ngày tải lên :
24/12/2013, 01:17
... modification to the database sqlDataAdapter1.Update(myDataTable); // display the DataRow objects in myDataTable // in the listView1 object foreach (MyDataSet.CustomersRow myDataRow2 in myDataTable.Rows) ... method of myDataTable myDataRow = myDataTable.FindByCustomerID("J5COM"); // modify the CompanyName and Address of myDataRow myDataRow.CompanyName = "Widgets Inc."; myDataRow.Address = "1 Any Street"; ... myDataTable.FindByCustomerID("J5COM"); myDataTable.RemoveCustomersRow(myDataRow); // push the delete to the database sqlDataAdapter1.Update(myDataTable); sqlConnection1.Close(); } Feel free to compile...
- 3
- 299
- 0
Tài liệu Controlling the Names Used in a Strongly Typed DataSet pdf
Ngày tải lên :
24/12/2013, 05:15
... typedPlural DataTable methods NewTableNameRowAddTableNameRowDeleteTableNa typedName meRow DataRowCollect TableName ion typedPlural DataRow TableNameRow typedName DataColumn DataTable.ColumnNameColumnDataRow.ColumnName ... available annotations for each Table 2-18 Default values and available annotations for elements of strongly typed DataSet objects Element Default name Annotatio n DataTable TableNameDataTable typedPlural ... DataTable.ColumnNameColumnDataRow.ColumnName typedName Property PropertyName typedName Child accessor GetChildTableNameRows typedChildr en Parent accessor TableNameRow typedParent DataSet events TableNameRowChangeEventTableNameRowChangeEv...
- 5
- 389
- 0
Tài liệu Creating a Strongly Typed DataSet pdf
Ngày tải lên :
21/01/2014, 11:20
... are: DataSet The DataSet used to specify the schema for the typed DataSet codeNamespace The target namespace for the typed DataSet codeGenerator A class capable of dynamically rendering source ... TypedDataSetGenerator class to generate a typed DataSet The second technique is to derive a class from the TypedDataSetGenerator class The static Generate( ) method of the TypedDataSetGenerator class ... class is used to create a strongly typed DataSet The prototype of the method is: public static void Generate(DataSet dataSet, CodeNamespace codeNamespace, ICodeGenerator codeGenerator); The arguments...
- 5
- 324
- 0
Csharp is a functional programming language
Ngày tải lên :
23/10/2014, 15:20
... pointer) closure in a functional language Generics (C# 2.0) Types (classes, interfaces, structs and delegates) can be parameterized on other types e.g delegate R Func (A arg); class List ... “polymorphic inheritance”: abstract class Expr class Lit : Expr { int val; … } class PairExpr : Expr { Expr e1; Expr e2; … } class Fst : Expr { Expr ... Tail(xs); } int v = Head(xs); Cost is O(n2)! Performance Closure creation and application are relatively cheap operations ◦ But almost no optimizations are performed Contrast ML/Haskell uncurrying,...
- 20
- 195
- 0
Tài liệu Reading a Column Value Using Strongly Typed DataSet Classes pptx
Ngày tải lên :
21/01/2014, 07:20
... you have your strongly typed MyDataSet class, you can create an object of that class using the following code: MyDataSet myDataSet = new MyDataSet(); You can also create a strongly typed DataTable ... System.Data.SqlClient.SqlDataAdapter(); mySqlDataAdapter.SelectCommand = mySqlCommand; MyDataSet myDataSet = new MyDataSet(); sqlConnection1.Open(); mySqlDataAdapter.Fill(myDataSet, "Customers"); sqlConnection1.Close(); ... This class is derived from the DataSet class You'll use it in the next section to create a strongly typed DataSet object to access the Customers table Using a Strongly Typed DataSet Class Once...
- 7
- 288
- 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
Ngày tải lên :
07/03/2014, 05:20
... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC Table Yeast strains used in this study Strain Genotype Source EGY48 AMY245 MATa his3 trp1 ura3 LexAop(·6)-LEU2 MATa vps4-D::KanMx leu2 ura3 his4 lys2 bar1 MATa ... superfamily typically contain one or two ATPase domains that assemble into one or two stacked hexameric rings The ATPase catalytic site is located at the interface between adjacent ATPase domains...
- 23
- 490
- 0
Báo cáo khoa học: Epl1, the major secreted protein of Hypocrea atroviridis on glucose, is a member of a strongly conserved protein family comprising plant defense response elicitors potx
Ngày tải lên :
07/03/2014, 12:20
... S, Comparini C, Calamassi R, Pazzagli L, Cappugi G & Scala A (2004) Cerato-platanin protein is located in the cell walls of ascospores, conidia and hyphae of Ceratocystis fimbriata f sp Platani ... Microbiol Lett 233, 341–346 25 Pazzagli L, Cappugi G, Manao G, Camici G, Santini A & Scala A (1999) Purification, characterization, and amino acid sequence of cerato-platanin, a new phytotoxic ... Leptosphaeria maculans) or human allergens and pathogenesis-related proteins (As-CG of Coccidioides immitis, Aca1 of Antrodia camphorata and Aspf13 of Aspergillus fumigatus) It should be noted that a...
- 14
- 494
- 0
Báo cáo khoa học: A DmpA-homologous protein from Pseudomonas sp. is a dipeptidase specific for b-alanyl dipeptides Hidenobu Komeda and Yasuhisa Asano docx
Ngày tải lên :
07/03/2014, 21:20
... primers were as follows: sense primer, 5¢-CACTTGAAGCTTTAAGGAGGA AtagACCATGCGTATCCGTGAGCTTGGCATCACC-3¢; antisense primer, 5¢-ACGCAATCTAGAGTCAGCCCTCA GGGGGCTTTCG-3¢ The amplified PCR product was digested ... (D-Ala)4, L-Ala-Gly, L-Ala-(Gly)2 (L-Ala)2, L-Ala-D-Ala, L-Ala-D-Ala-L-Ala, DL-Ala-DL-Asn, DL-Ala-DL-Ile, DL-Ala-DL-Leu, DL-Ala-DL-Met, DL-AlaDL-Phe, DL-Ala-DL-Ser, DL-Ala-DL-Val, L-Asp-D-Ala, L-Pro-Gly, ... L-Ala-pNA D-Ala-NH2 L-Ala-NH2 D-Ala-(Gly)2 L-Ala-(Gly)2 b-Ala-L-Ala b-Ala-Gly b-Ala-NH2 b-Ala-L-His (Carnosine) b-Ala-L-Leu (b-Ala)2 similarity to that from dmpA of O anthropi LMG7991 DmpA has...
- 10
- 406
- 0
Báo cáo khoa học: "MIX Is Not a Tree-Adjoining Language" doc
Ngày tải lên :
16/03/2014, 19:20
... F(aa¯ a, aaaa) a ¯ ¯ A( a, a) F (a , aa) a ¯ A( a, a) D (a , aa) a ¯ E (a a, aaa) a ¯ ¯ D (a , aa) a ¯ C( ε, #) A (¯ , a) a ¯ D(ε, ε) F (a , aa) a ¯ A( a, a) D(ε, ε) E(¯ , a) a ¯ D(ε, ε) A (¯ , a) ... A, A , C, D, E, F}, Σ = {a, a, #}, and P consists of the following rules: S(x1 y1 , y2 x2 ) ← D(x1 , x2 ), C( y1 , y2 ) C( ε, #) ← S(aa¯ aa¯ , #¯ a aaa) a a a a D(aa¯ aa¯ , aa¯ aaa) a a ¯ a ... Characterizing structural descriptions produced by various grammatical formalisms In 25th Annual Meeting of the Association for Computational Linguistics, pages 104–111 David J Weir 1988 Characterizing...
- 9
- 374
- 0
Báo cáo khoa học: A pathway through interferon-c is the main pathway for induction of nitric oxide upon stimulation with bacterial lipopolysaccharide in mouse peritoneal cells pot
Ngày tải lên :
17/03/2014, 10:20
... downstream 47 base pairs, designated NF-jBd (5¢-CAT GGG GAC TCT CCC TTT GGG AAC AGT TAT GCA AAA TAG CTC TGC AGA GCC TGG AGG GGT CGA-3¢) [12] and the IRF-1 consensus sequence oligonucleotide (5¢-GGA AGC ... obtained 24 h after stimulation The concentration of each cytokine was measured using a speci c sandwich ELISA, according to the manufacturer’s instructions (Endogen) using matched antibody pairs ... macrophage cell line RAW264.7, originally from the American Type Culture Collection (Manassas, VA, USA) and maintained in our laboratory, was also used For cell culture, RPMI-1640 (Dainippon Pharmaceutical...
- 10
- 395
- 0
English is a crazy language pptx
Ngày tải lên :
25/03/2014, 01:21
... smell: chân c mùi Park: đỗ xe Driveway: đường lái xe vào t a nhà Parkway: đại lộ How can a slim chance and a fat chance be the same, while a wise man and wise guy are opposites? How can overlook and ... preacher praught? If a vegetarian eats vegetables, what does a humanitarian eat? If you wrote a letter, perhaps you bote your tongue? preacher: linh m c Vegetarian: người ăn chay Humanitarian: ... opposites, while quite a lot and quite a few are alike? How can the weather be hot as hell one day and cold as hell another Slim chance = fat chance: c hội Wise man: người thông thái Wise guy: kẻ hợm...
- 7
- 509
- 0
Báo cáo khoa học: Helicobacter pylori neutrophil-activating protein activates neutrophils by its C-terminal region even without dodecamer formation, which is a prerequisite for DNA protection – novel approaches against Helicobacter pylori inflammation ppt
Ngày tải lên :
30/03/2014, 04:20
... TTCCACGCGAAGTTATGCACTTTCAT-3¢, 5¢-AATTTC TTCAGTGGCTTTCGCCACATTGAAAAAATCGGT-3¢, 5¢-GATCCTTTCAGCGAGATCCGCAAACATGTCCGC AAACTC-3¢ and 5¢-TTGCAGCATCCAAATGGACGCTT GCAACTTGGCCAATTG-3¢ for H2 5A, H3 7A, D5 2A ... (5¢-GCGGGATCCTTAAGCCAAATGGGCTTG-3¢), HPNAP_up (5¢-GCGGAATTCCATATGAAAACATTTG AAATT-3¢) and HPNAP_low (5¢-CCGCTCGAGAGCC AAATGGG-3¢), for pET1 1a and pET2 9c, respectively The restriction sites for NdeI, BamHI, EcoRI and ... vectors pET-1 1a and pET2 9c The hpnap gene was amplified by PCR from the H pylori J99 genome using primers HPNAP_up (5¢-GCGGAA TTCCATATGAAAACATTTGAAATT-3¢) and HPNAP_ low (5¢-GCGGGATCCTTAAGCCAAATGGGCTTG-3¢),...
- 16
- 351
- 0
Báo cáo khoa học: Unique proteasome subunit Xrpn10c is a specific receptor for the antiapoptotic ubiquitin-like protein Scythe docx
Ngày tải lên :
30/03/2014, 11:20
... (Novagen, Madison, WI, USA), Myc (9E10; Santa Cruz Biotechnology, Santa Cruz, CA, USA), Flag M2 (Sigma) and GFP (Clontech) and then incubated with horseradish peroxidase-conjugated antibody against ... mouse Rpn1 0c cDNA named xrpn1 0c Here we report that Xrpn1 0c is a speci c receptor of 6374 Scythe ⁄ BAG-6 We found that an Xrpn1 0c- speci c C-terminal sequence is required and sufficient for Scythe binding ... the blastulae stage, each embryo was individually harvested, crushed in NaCl ⁄ Pi, and centrifuged to collect the cytoplasmic fraction Samples of this fraction were used for immunoprecipitations...
- 14
- 279
- 0
Báo cáo Y học: Arginine 121 is a crucial residue for the specific cytotoxic activity of the ribotoxin a-sarcin potx
Ngày tải lên :
31/03/2014, 23:20
... or His137, residues acting as the general acid and base on the catalysis by a- sarcin [19,20], rendered proteins with no detectable activity against ApA [20] Cleavage of ApA by a- sarcin is a low-specificity ... indicate that this residue plays an important role in the rRNA catalytic cleavage by a- sarcin, which would not be simply related to the bearing positive charge Both mutant variants of a- sarcin cleave ... & Vallee, B.L (1986) Isolation and characterization of a human colon carcinomasecreted enzyme with pancreatic ribonuclease-like activity Biochemistry 25, 7255–7264 ´ ´ ˜ 45 Mancheno, J.M., Gasset,...
- 7
- 434
- 0
Báo cáo sinh học: " High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" potx
Ngày tải lên :
18/06/2014, 22:20
... primary blasts Haematologica 2008, 93:662-669 34 Sharma SV, Haber DA, Settleman J: Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents Nat Rev Cancer ... Conveniently, it is standard clinical practice to perform karyotyping on hematological cancer cells and chromosome number can serve as an attractive resistance marker for patient response enrichment for ... Gautschi O, Mack PC, Davies AM, Lara PN, Gandara DR: Aurora kinase inhibitors: a new class of targeted drugs in cancer Clin Lung Cancer 2006, 8:93-98 Page 10 of 10 37 Mazzino A, Muratore-Ginanneschi...
- 10
- 618
- 0
o cáo hóa học:" High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" ppt
Ngày tải lên :
20/06/2014, 04:20
... primary blasts Haematologica 2008, 93:662-669 34 Sharma SV, Haber DA, Settleman J: Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents Nat Rev Cancer ... Conveniently, it is standard clinical practice to perform karyotyping on hematological cancer cells and chromosome number can serve as an attractive resistance marker for patient response enrichment for ... Gautschi O, Mack PC, Davies AM, Lara PN, Gandara DR: Aurora kinase inhibitors: a new class of targeted drugs in cancer Clin Lung Cancer 2006, 8:93-98 Page 10 of 10 37 Mazzino A, Muratore-Ginanneschi...
- 10
- 665
- 0
Let''''s face it -- English is a crazy language pps
Ngày tải lên :
12/07/2014, 15:20
... a horsehair mat is made from the hair of horses, from what is a mohair coat made? A slim chance and a fat chance are the same, as are a caregiver and a caretaker, a bad licking and a good licking, ... computers As such, language reflects the creative and fearful asymmetry of the human race, which, of course, isn't really a race at all That's why we wear a pair of pants but, except on very cold days, ... told, all languages are a little crazy As Walt Whitman might proclaim, they contradict themselves That's because language is invented, not discovered, by boys and girls and men and women, not computers...
- 6
- 297
- 0
English Language Proficiency Tests-Advanced Level''''sarchiveReal Life: What is a SOHO (1) potx
Ngày tải lên :
25/07/2014, 12:20
... separate twist 2.M: There is also another to working as a SOHO For example, people could easily get sidetracked and not get any work done W: Really? I think I can motivate myself and I could ... family advantage drawback benefit 3.M: In addition, you won't have any professional training provided free-of-charge by a company and you won't be able to develop strong relationships with colleagues ... But, this kind of work arrangement will not be suitable for everyone Some folks can't deal with all of the that can occur at home like children or housework — and may not be able to concentrate...
- 10
- 411
- 0