c hlamydia pneumoniae infection in patients with abdominal aortic aneurysm

... HBV/HCV co-infected with occult HBV infection (HBsAg negatives) The 30 patients with uncertain HBV status were not included The mean age was significantly higher in patients with occult HBV infection ... chronology of contamination with the two viruses: HCV superinfection in previously HBV infected patients, co -infection or HBV infection in HCV positives [30,31] Among the mechanisms accounting for the ... hepatitis C virus coinfection Ann Clin Microbiol Antimicrob 2005, 4:13 31 Sagnelli E, Coppola N, Marrocco C, Onofrio M, Sagnelli C, Coviello G, Scolastico C, Filippini P: Hepatitis C virus superinfection...

Ngày tải lên: 12/08/2014, 01:21

... infections treated with antibiotics All adverse events collected, reported only if occurred in or more patients 17 infections in 40 patients in GC arm, 22 infections in 41 patients in placebo arm Total ... Hyrich KL, Silman AJ, Symmons DPM: Rates of serious infection, including site-specific and bacterial intracellular infection, in rheumatoid arthritis patients receiving anti-tumor necrosis factor ... only for the arms comparing GC therapy with no-GC exposure If studies were explicit in describing the methods by which they captured infection, nonreporting of infection within the results was...

Ngày tải lên: 12/08/2014, 17:22

... Thrombin may also affect the production of inflammatory cytokines by binding to protease-activated receptors (PARs) in mononuclear cells [3] Secondly, rhAPC may inhibit the action of plasminogen activator ... (Behring Coagulation System, BCS) with reagents and protocols from Available online http://ccforum.com/content/9/5/R490 Table Baseline characteristics of the patients Characteristic rhAPC group ... of cells by blocking nuclear factor kappa B nuclear translocation, which is required for increases in proinflammatory cytokines and adhesion molecules [5] Direct activation of PAR-1 by the APC-EPCR...

Ngày tải lên: 12/08/2014, 22:22

... [17] concluded that there was no increased preponderance of fungal infection in patients in the treatment arms compared to placebo, this finding is not necessarily at odds with evidence of increased ... patients at increased risk for candidal infections in the surgical intensive care unit: approach to developing practical criteria for systematic use in antifungal prophylaxis trials Med Mycol 2005, ... for necrotizing pancreatitis Currently, according to the ecological impact of antimicrobial prophylaxis, antifungals should be considered for all patients receiving it However, my second recommendation...

Ngày tải lên: 13/08/2014, 03:20

... in oedema fluid collected by bronchoscopic microsampling of patients with ARDS, and confirmed primary human epithelial cell production of KL-6 in response to proinflammatory cytokines [8] Both ... in ARDS since the levels reflect the severity of lung injury and neutrophilic inflammation but not the presence of alveolar infection Materials and methods Participants Consecutive patients with ... of lung injury The presence of active alveolar infection was defined by the presence of >104 colony-forming units of pathogenic bacteria in BALF (irrespective of mode of injury) A significant growth...

Ngày tải lên: 13/08/2014, 10:20

... Catovic et al Journal of Cardiothoracic Surgery 2011, 6:51 http://www.cardiothoracicsurgery.org/content/6/1/51 Introduction In routine clinical practice significant number of the patients with ... effective aortic valve orifice According to actual guidelines for treatment of patients with valvular heart diseases, in symptomatic patients with confirmed AS, surgical aortic valve replacement ... article as: Catovic et al.: Impact of concomitant aortic regurgitation on long-term outcome after surgical aortic valve replacement in patients with severe aortic stenosis Journal of Cardiothoracic...

Ngày tải lên: 10/08/2014, 09:21

... (forward primer, 5’-CTGCCTGGCAGAAAACTTACC-3’; reverse primer, 5’-CTCTGTTATTCTCTGGTGAGTCT CCTT-3’; probe, 5’CATCACACATATCTGTAAATCTC TGCCCCTGTTAGA-3’) Co-amplification of the betaglucuronidase gene ... manuscript; PZ was responsible for performing selection of patients with CHC and analysing of clinical data; JV was responsible for performing selection of patients with CHC and analysis of clinical ... MA, Carreño V: In vivo and in vitro induction of MxA protein in peripheral blood mononuclear cells from patients chronically infected with hepatitis C virus J Infect Dis 1999, 180:262-267 Erickson...

Ngày tải lên: 12/08/2014, 02:20

... 10], chronic infections and asthma [11, 12] The objective of the present study was to assess changes in the concentration of CRP in patients with pulmonary tuberculosis infection The CRP can serve ... Point-of-care C- reactive protein testing in febrile children in general practice Clin Chem Lab Med., 44: 1428-1432 20 Cohen, R., O Romain, C Levy, F Perreaux and M Decobert, 2006 Impact of CRP ... very interesting to note that sputum conversion and x-ray findings improvement is concomitant with negative C- reactive protein reaction The changes in serum CRP concentration during treatment with...

Ngày tải lên: 15/03/2014, 03:20

... significantly In several domains the decline was around points on the norm based scale and hence were likely clinically significant This is similar to the observation in naïve patients with HCV infection ... Table 4: Change in SF-36 norm based Domain scores in non-responders among refractory HCV patients re-treated with pegylated interferon alpha 2b and ribavirin SF-36 domain Change in scores compared ... adherence and sustained response in chronic hepatitis C patients Hepatology 2002, 35:704-708 McHutchison JG, Ware JE Jr, Bayliss MS: The effects of interferon alpha-2b in combination with ribavirin...

Ngày tải lên: 20/06/2014, 15:20

... EORTC QLQ -C3 0 version 3.0 and the EORTC QLQ-CR38 The EORTC colorectal questionnaire (QLQ-CR38) was developed to be used in conjunction with the QLQ -C3 0 The FACT -C combines the FACT-G with a CRC ... (ICC) of the QLQ -C3 0, QLQCR38 and FACT -C for patients with stable colorectal cancer undergoing chemotherapy (data obtained between the third and the fourth treatment) n ICCa 95% CIb EORTC QLQ -C3 0: ... Well-Being 34 0.73 0.52-0.85 Colorectal Cancer Specific FACT -C total score 34 34 0.77 0.75 0.59-0.90 0.55-0.87 Trial Outcome Index-Colorectal 34 0.82 0.66-0.90 a Intraclass correlation coefficient;...

Ngày tải lên: 20/06/2014, 15:20

... deficiency Beyond bone health, vitamin D deficiency is associated with many chronic diseases such as cancer, cardiovascular disease, diabetes and immunological diseases including HIV as well as chronic ... doi:10.1186/1742-6405-7-40 Cite this article as: Conesa-Botella et al.: Decrease of vitamin D concentration in patients with HIV infection on a non nucleoside reverse transcriptase inhibitor-containing regimen ... Katlama C, Costagliola D: Greater decrease in bone mineral density with protease inhibitor regimens compared with nonnucleoside reverse transcriptase inhibitor regimens in HIV-1 infected naive patients...

Ngày tải lên: 10/08/2014, 05:21

... shifting the whole right renal to the middle line intra -abdominal forces produce elevations in measured hemodynamic parameters including CVP and PAWP resulting in false LVAD or PVAD settings In ... complications and ventricular filling and uploading but CT detected in all cases the problem Common CT features included extrinsic compression of the inferior vena cava (IVC), positive round belly ... syndrome: does intra-cystic pressure reflect actual intra -abdominal pressure? A prospective study in surgical patients Critical Care 1999, 3:135-138 32 Pickhardt PJ, Shimony JS, Heiken JP, Buchman TG,...

Ngày tải lên: 10/08/2014, 09:22

... production of the excess of Tn -C in patients with COPD The clinical relevance of our finding can only be speculated Hypothetically, increased ECM deposition in the large airways in our COPD patients ... tissue section was analyzed by immunohistochemistry in each case Immunohistochemical stainings for Tn -C and a-SMA was performed in serial sections, i.e in consecutive sections Staining for desmin was ... Tenascin -C and a-SMA in patients with COPD, smokers (S) and non-smokers (NS) COPD S NS Tenascin C (Tn -C) Number of acceptable biopsies 20 12 14 Subjects expressing Tn -C only in basal epithelial cells...

Ngày tải lên: 12/08/2014, 13:22

... one of our patients had recurrent infections In fact, the present data from case indicate that B lymphocytes are still capable of producing specific antibodies (such as anti-EBV IgG) As with many ... cavopulmonary connection procedure), the patient was referred to our Cardiac Centre because she had suspected infection, again accompanied by oedema and markedly reduced exercise tolerance On admission ... PLE Indeed, the infections we identified around the time of onset of PLE are not uncommon in children Conclusion Our observation in postoperative patients with Fontan circulation may indicate...

Ngày tải lên: 12/08/2014, 19:22

Ngày tải lên: 12/08/2014, 19:22

... A, Putensen C: Prone positioning, systemic hemodynamics, hepatic indocyanine green kinetics, and gastric intramucosal energy balance in patients with acute lung injury Intensive Care Med 2002, ... variance; CI, cardiac index; Cst, respiratory static compliance; CVP, central venous pressure; EVLWI, indexed extravascular lung water; FiO2, fraction of inspired oxygen; ITBV, intrathoracic blood ... hemodynamic monitoring In Yearbook of Intensive Care and Emergency Medicine Edited by: Vincent J Berlin: Springer; 1995:593-605 17 Iberti T, Lieber C, Benjamin E: Determination of intra-abdominal...

Ngày tải lên: 12/08/2014, 22:21

Ngày tải lên: 12/08/2014, 22:22

... because of persistent organ dysfunction, in association with infected pancreatic necrosis in three patients Discussion score in patients with severe intra -abdominal pressure and APACHE II Correlation ... multiple intra -abdominal fluid collections were present on CT scan on admission, or when there was the clinical suspicion of IAH These clinical indications included oliguria, hypoxia, abdominal distension, ... syndrome in four patients and infected pancreatic necrosis in five patients Abdominal decompression was performed surgically through a midline laparotomy In four patients, a temporary abdominal closure...

Ngày tải lên: 12/08/2014, 22:22

... between interleukin-6 plasma concentration in patients with sepsis, monocyte phenotype, monocyte phagocytic properties, and cytokine production Clin Infect Dis 2000, 31:1338-1342 Gebhard F, Pfetsch ... NJ, Copeland EM III, Moldawer LL: The relationship between visceral ischemia, proinflammatory cytokines, and organ injury in patients undergoing thoracoabdominal aortic aneurysm repair Crit Care ... performed because cHydrocortisone treatment was initiated for relative adrenal insufficiency APACHE, Acute Physiology and Chronic Health it was considered futile Evaluation; CVC infection, central...

Ngày tải lên: 13/08/2014, 02:24

... greatly increased risk for bleeding while receiving APC Because such patients were excluded from the major clinical trials of APC, it may be prudent to withhold therapy with APC from all patients with ... epistaxis In a multivariate regression model that included race, sex, and Acute Physiology and Chronic Health Evaluation II score, cirrhosis remained independently associated with the risk of a bleeding ... trials that include these patients, or further postmarketing data, are available Competing interests The authors declare that they have no competing interests References Bernard GR, VIncent JL,...

Ngày tải lên: 13/08/2014, 08:21