... Thu’s school? 8. How many students are there in Thu’s school ? 9. LN - Call on some pairs to practice in the class. - Get feedback. - Check up and correct their predictions . * Phong’s school ... feedback. 4. Production . (10’) “Word cue drill” - Give instruction and check. - Ask Ss to use the cue in C4 on page 19 and work in pair to practice. - Let them have time to practice. - Call ... and things at school. 19 m c thÞ söu English 6 n¨m h c; 2008 – 2009 How are you ? I’m fine, thanks. * Concept check: meaning, form, usage and pronunciation. 3. Practice . (15’) * Picture drill. -...
Ngày tải lên: 25/06/2013, 01:27
... so we concentrate on the price function pseudocode for the price function If turnover <= 7 days then return (cost + 5% of cost); else return (cost + 10% of cost); Slide 5- 35 Copyright ... function call Call-by-reference parameters allow us to change the variable used in the function call Arguments for call-by-reference parameters must be variables, not numbers Slide 5- 18 Copyright ... Education, Inc. Publishing as Pearson Addison-Wesley Using Procedural Abstraction Functions should be designed so they can be used as black boxes To use a function, the declaration and comment should...
Ngày tải lên: 12/09/2012, 22:49
Games (for 3+4) ( things for school).ppt
... 1 LUCKY 2 Topic Topic : THINGS FOR SCHOOL B A G 8 CHECK VOCABULARY 1 LUCKY 2 Topic Topic : THINGS FOR SCHOOL R U L E R 5 1 LUCKY 2 Topic Topic : THINGS FOR SCHOOL P E N 7 1 LUCKY 2 Topic Topic ... 1 LUCKY 2 Topic Topic : THINGS FOR SCHOOL P E N C I L 2 1 LUCKY 2 Topic Topic : THINGS FOR SCHOOL E R A S E R 3 1 LUCKY 2 Topic Topic : THINGS FOR SCHOOL B O O K 4 1 LUCKY 2 Topic Topic : THINGS FOR SCHOOL D...
Ngày tải lên: 06/09/2013, 13:10
Building C++CLI Programs for the .NET Developer Platform with Visual C++
... mode, except for the code in Chapter 12, which deals specifically with unverifiable code, and code that uses specific constructs such as unsafe uses of static_cast. If you’re familiar with C# , ... any specific processor architecture. However, as you’ve seen, code compiled with /clr rather than /clr:pure or /clr:safe may contain plat- form-specific code. Also, even in pure mode, you can invoke ... compiler (or cross-compiler) for that architecture. Visual C+ + 2005 ships cross-compilers for x64 and Intel Itanium architectures, so you can generate code on an x86 computer that will execute...
Ngày tải lên: 05/10/2013, 07:20
Tài liệu Is Your Network Ready for GPON? docx
... LCC-13-BE LCC-26-BE LCC-31-BE bulk (100 pack) LCC-1B-BE LCC-13B-BE LCC-26B-BE LCC-31B-BE Crimp Tools Features ergonomic handle for ADC die sets WT-2 Features long ergonomic handle for ADC die sets ... Analog Video SHDC-LCC High-Performance, HD SHDC-LCC-HP Straight-Through High-Performance, HD SHDC-LCC-NN 1.0/2.3 connectors Normalling AES and Analog Video SHDC-1023 High-Performance SHDC-1023-HP Straight-Through ... High-Performance SHDC-1023-NN Ordering Information Description Catalog Number LCP High-Performance Patch Cords 2 feet BK2VXM-LCP-LCP 3 feet BK3VXM-LCP-LCP 4 feet BK4VXM-LCP-LCP 6 feet BK6VXM-LCP-LCP Ordering...
Ngày tải lên: 17/01/2014, 11:20
Tài liệu KRONE - Guide - Is your cabling system ready for PoE doc
Ngày tải lên: 24/01/2014, 03:20
Tài liệu KRONE - Guide - Is your Cabling System ready for VoIP ppt
... frequently checked during installation by the endorsed installer company for practices which may contribute to non-compliance and then tested before hand-over to ensure compliance with the relevant specification in ... in between the switch and network connections inside the Telecommunications Room. Note: Be aware that some computer Network Interface Cards (NIC) cannot tolerate voltage on communication pairs. External ... specification in the building contract. For IP Telephony to be successfully implemented; 1. All four pairs of the cable must be connected in a structured cabling system. 2. The network cabling...
Ngày tải lên: 24/01/2014, 03:20
c# 2010 AIO for dummies
... Concept #2: Classi cation 209 Why Classify? 210 Object-Oriented Concept #3: Usable Interfaces 211 Object-Oriented Concept #4: Access Control 212 How C# Supports Object-Oriented Concepts 212 Chapter ... Dummies.com *Sweepstakes not currently available in all countries; visit Dummies.com for official rules. Get More and Do More at Dummies.com ® To access the Cheat Sheet created specifically for this ... III: Designing for C# 399 Chapter 1: Writing Secure Code 401 Chapter 2: Accessing Data 415 Chapter 3: Fishing the FileStream 435 Chapter 4: Accessing the Internet 455 Chapter 5: Creating Images...
Ngày tải lên: 24/01/2014, 18:04
Tài liệu Communicable Diseases Summary: A Guide for School Health Services Personnel, Child Care Providers and Youth Camps doc
... 16 Staphylococcal Infection 28 Strep Throat See Streptococcal Infection Streptococcal Infection 29 Streptococcus pneumoniae See Pneumococcal Disease Syphilis 29 TB (Tuberculosis) 30 Tickborne Illnesses ... section for “Varicella zoster virus: Chickenpox”.] [Also, see SHS “Guide for Emergency Care in Maryland Schools, 2005” section for “Rashes”.] Communicable Diseases Summary: Guide for Schools, Child ... abuse. [Also, see SHS “Guide for Emergency Care in Maryland Schools, 2005” section for “Child Abuse and Neglect”.] Communicable Diseases Summary: Guide for Schools, Child Care, and Youth Camps Maryland Department...
Ngày tải lên: 12/02/2014, 11:20
Tài liệu Managing asthma A Guide for Schools pptx
... of classmates who have asthma. Actions for the School Nurse MANAGING ASTHMA: A GUIDE FOR SCHOOLS iv School Education Subcommittee Lani S. Wheeler, M.D., F.A.A.P., F.A.S.H.A. (Chair) American School ... in accordance with school policy and State mandates. Provide easy access to emergency medications. Support self-administration when appropriate. Consult medical and State Nurse Practice Acts ... asthma School policies and procedures for administering medications, including protocols for emergency response to a severe asthma episode Specific actions for staff members to perform in...
Ngày tải lên: 14/02/2014, 09:20
Tài liệu First Principles: Designing Effective Education Programs for School Health in Developing Countries doc
... Existence of national-level school environment (inspection) standards 3. Percentage of schools with a safe, sufcient, and accessible water supply 4. Percentage of schools with sufcient, accessible, ... national-level curricula for primary and secondary schools 2. Generic and content-speci c life skills concepts and themes explicitly assessed in national-level school- leaving examinations
Ngày tải lên: 14/02/2014, 13:20
Tài liệu Teacher Training: Essential for School-Based Reproductive Health and HIV/AIDS Education docx
... These factors make young people reluctant to con- fide in their teachers. Chapter 5. Teacher Selection Teacher Selection Criteria Checklist The following checklist of selection criteria can assist ... Impact 6 Chapter 3. African Setting Poses Challenges 8 Chapter 4. Teacher Training Projects in Africa 12 Chapter 5. Teacher Selection 17 Chapter 6. Assessing Teacher Training Curricula 18 Chapter ... who care for HIV-infected persons. Management and Structure The curriculum should include information on the structure of the school environment, resources available within the school and com- munity,...
Ngày tải lên: 14/02/2014, 13:20
Prevention and Control of Communicable Diseases: A Guide for School Administrators, Nurses, Teachers, Child Care Providers, and Parents or Guardians pptx
... Control of Communicable Diseases, A Guide for School Administrators, Nurses, Teachers, and Child Care Providers”. DISCLAIMER - In clinical practice, certain circumstances ... disinfecting; guidelines for specific items commonly used in the childcare and school setting; and a checklist for choosing a disinfectant other than bleach. Definitions Cleaning Mechanical ... products can be used in childcare and school settings. Green sanitizers or disinfectants must be approved by your local public health agency or your childcare consultant. For more information,...
Ngày tải lên: 05/03/2014, 10:20
Guidelines for School Programs To Prevent Skin Cancer docx
... Association for Health Education;* American Cancer Society;* AMC Cancer Research Center and Foundation;* American Optometric Association;* American Pharmaceutical Association;* American School Health ... other school staff (e.g., coaches and school nurses). Skin cancer prevention can be integrated into these activities. All school staff should receive basic information concern- ing the importance ... McAlpine BE. Personal and clinical skin cancer prevention practices of U.S. women physicians. Arch Derm 2000;136:633–42. 60. McDonald CJ. American Cancer Society perspective on the American College...
Ngày tải lên: 06/03/2014, 02:21
PERIPHERAL BLOOD BASED C-PCR ASSAY FOR DIAGNOSING EXTRA-PULMONARY TUBERCULOSIS pdf
... was: Forward primer (FW) 5- TCCGCTGCCAGTCGTCTTCC-3 and Reverse primer (RW) 5- GTCCTCGCGAGTCTAGGCCA – 3. Amplification reaction was performed in 25 l of master cocktail containing ... quantification of mycobacterial Fig. 6—Representative agarose gel electrophoresis picture(s) of C- PCR amplified products for the calculation of mycobacterial load from peripheral blood specimens ... used specimen for revealing the presence of tubercle bacilli in TB. However, its clinical significance in EPTB is very discouraging 3 . The diagnosis in such cases posses great challenge...
Ngày tải lên: 06/03/2014, 04:20
ASCA NATIONAL MODEL : A FRAMEWORK FOR SCHOOL COUNSELING PROGRAMS docx
Ngày tải lên: 06/03/2014, 19:20