c fate and future of constitutional reform

... Pigneur, and C. L Tucci Authors that describe a number of different abstract types of business models (i.e a classification scheme), each one describing a set of businesses with common characteristics ... of customers and of the architecture of the firm and its network of partners for creating, Communications of AIS, Volume 15, Article Clarifying Business Models: Origins, Present, and Future of ... Communications of AIS, Volume 15, Article Clarifying Business Models: Origins, Present, and Future of the Concept by A Ostenwalder, Y Pigneur, and C. L Tucci and the future of the business model concept,...

Ngày tải lên: 15/03/2014, 21:20

... GGCGATGGTTGCGCGAAGCCCAACCGGCCCGGCATCTACACCCGCGTCACCTCCTACCTGGACTGGATCCAC 792 CAGTACGTCCCCCAGGGGCCCtgagcctggtccccaggccgccccctgggtcagcggaggagctggccccca 864 ♦ cagtcccctcaacactgcttccggccgaggaggagaccttcccccaccttccccggccccctgtcccagtgc ... CAGTACGTCCCCCAGGGGCCCtgagcctggtccccaggccgccccctggtcagcggaggagctggccccctc 864 Q Y V P Q G P ♦ (245) tgtcccctcagcgctgcttccggcccgaggaggagaccttcccccaccttccctggccccctgcccaatgcc 936 cacccctggctgacccctctctgctgacccctccctgccctgaacccctgccccagccccctccccactagc ... cacccctggctgacccctctctgctgacccctccctgccctgaacccctgccccagccccctccccactagc 1008 tcagggcgctggcaggggctgctgacactcataaaaagcatggagagcag 1058 B -20 AGCAGCCTGGACCTGCCAAG -1 ATGCTCCATCTGCTGGCGCTCGCCCTCCTGCTGAGCCTGGTCTCCGCAGCCCCTGGCCAGGCCCTGCAGCGC...

Ngày tải lên: 17/03/2014, 09:20

... (TCDD and HxCDD) Total PCDDs: 429 Principal congeners concentration: 9.02390 (TCDD, PeCDD, HxCDD and OCDD) Total PCDFs: 489 Principal congeners concentration: 45.9281 (TCDF and PeCDF) Total PCDFs: ... Principal congeners concentration: 1.174.52 (TCDF, PeCDF and HxCDF) Total PCDFs: 0.667 Principal congeners concentration: 0.0410.386 (TCDF and PeCDF) Total PCDFs: 36,250 Principal congeners concentration: ... Japanese standard Table PCDD/Fs concentrations in ashes and soils of Guiyu (China) and comparison values Total PCDD/Fs Total PCDDs and principal congeners concentration Total PCDFs and principal congeners...

Ngày tải lên: 23/03/2014, 04:20

... might change or TC39 might consider ECMAScript.next as having become too large and discard features Block scoping via let and const In current JavaScript, variables are function-scoped—if you declare ... Google’s Traceur compiles a variant of ECMAScript.next to JavaScript, on the fly • Emscripten compiles LLVM bitcode to JavaScript That bitcode can be generated from C and C+ +, which means that ... Hence, there is another code name, ECMAScript.next, for the next version of ECMA- The future | Script ECMAScript.next will probably become ECMAScript Harmony’s requirements and goals are described...

Ngày tải lên: 24/03/2014, 04:21

... Scholarship (to M.F.) from the Natural Sciences and Engineering Research Council of Canada (NSERC) and by fellowship and grant support from the National Health and Medical Research Council of ... the means of two determinations Uptake of 59Fe from sMTf and Tf as a function of ligand concentration The uptake of 59Fe from Tf and sMTf was also investigated as a function of ligand concentration ... internalization of 125I-sMTf cannot be inhibited by an excess of nonradioactive 56Fe-Tf Indeed, a nonspeci c process such as pinocytosis has a large capacity for ligand uptake and will not be...

Ngày tải lên: 31/03/2014, 09:20

... explosive chain-branched reaction, and another model describes the motion of pendulums, the dynamics of cryogenic electronic devices, and the dynamics of muscle contractions during childbirth Ordinary ... electrical circuits composed of resistors, inductors, and capacitors Figure 1.2 shows an RLC circuit, in which Vin , R, L, and C are given, and the unknowns are the output voltage (V ) and the current ... ergodic theories for dynamical systems and random processes, and Poincar´ had a clear image of the chaotic behavior e of dynamical systems that occurs when stable and unstable manifolds cross...

Ngày tải lên: 24/04/2014, 16:50

... Fisica Cosmica, CNR, 20133 Milano, Italy Lawrence Berkeley and Space Science Laboratory, Berkeley, CA 94720, USA ABSTRACT - The results of ground-based measurements of the cosmic microwave background ... they can be seen to large distances, and hence the Hubble constant can be measured on scales ~ Gpc without recourse to the usual cosmic distance ladder and without the need for significant corrections ... Sunyaev-Zel'dovich effect is seen at the point closest to the X-ray center for each cluster (offset from the scan center in the case of Abell 665), and the apparent angular sizes of the effects are consistent...

Ngày tải lên: 03/07/2014, 21:10

... the symptom of deep-rooted social and economic contradiction and conflict, between major economic groups claiming pieces of the pie that together exceed the whole pie," wrote Yale economist James ... domestic policy blunder since World War II: the perverse consequence of wellmeaning economic policies, promoted by some of the nation's most eminent academic economists These policies promised to control ... Ackley, chairman of the Council of Economic Advisers, and Charles Schultze, then director of the Bureau of the B u d g e t — r e c o m m e n d e d a tax increase to 15 THE GREAT INFLATION AND ITS AFTERMATH...

Ngày tải lên: 01/11/2014, 21:43

... coefficient (β) and mass transfer coefficient (ω) 107 3.7 Freundlich coefficient (KF) and exponent (N) of chlortetracycline (CTC) 108 B B 3.8 Freundlich coefficient (KF) and exponent (N) of ... speciation of (a) chlortetracycline (CTC), (b) tylosin (TYL), and (c) sulfamethazine (SMT) 115 3.3 Two conformations of chlortetracycline (CTC) 115 3.4 Effect of pH on chlortetracycline ... factor (S), cover-management factor (C) , and support practice factor (P) Fertilizer application methods may influence C, which depends on prior land use, canopy-cover, surface-cover and surface-roughness,...

Ngày tải lên: 13/11/2014, 09:16

... to SO3 (contact process) Definition of catalysis Oxidation of NH3 to nitric acid HCl + O2 → Cl2 Esterification of acid Hydrolysis of esters Sulfuric acid Friedel-Crafts reactions Nitric acid synthesis ... catalysts arose from the fluid catalytic cracking (FCC) process for oil transformation to fuels and chemicals The addition of zeolites (FAU and MFI) to acid clays and silica–alumina cracking catalysts ... Hydrodesulfurization (HDS) and fluid catalytic cracking (FCC) Gasoline has the highest concentration of sulfur compounds in the FCC (fluid catalytic cracking) stage of the refinery process Environmental...

Ngày tải lên: 09/10/2015, 00:06

... Bohra clergy 53 The strict avoidance of political activity by members of the community seems to be in line with much of broader Shia customs of secrecy and quietism, i.e., the practice of taqqiya ... agitations which could risk the existence of the community Second, the crucial concept of taqqiya or dissimulation permits the community to accept the dictates of the temporal authority of the time, ... ethical life scenarios Noting that the ‘community’ as a historical concept may be of urgent theoretical and practical relevance, Chatterjee grounds the definition of ‘community’ (in this case of...

Ngày tải lên: 01/10/2015, 11:39

... much shorter time Communicate with handheld devices seamlessly to access data and applications Enhance data transfer using the load balancing function, which can detect bandwidth capability and ... handheld device according to the connectivity platforms like CDPD,SMS, Mobitex, and CDMA The application server must accommodate for the different handheld platforms such as, thin client devices ... Application Programming Interface Composite Capability/ Preferences Profiles Code Division Multiple Access Common Gateway Interface Capability and Preference Information Digital Communications...

Ngày tải lên: 26/10/2013, 16:15

... Japanese Ministry of Education, Culture, Sports, Science and Technology; the Japan Society for the Promotion of Science; and the Japan Science and Technology Agency References 13 14 15 Pawson ... fluorescence and immunocytochemical staining with anti-Flag or anti-HA sera Cell images were acquired by confocal microscopy (LSM510; Carl Zeiss, Inc., Oberkochen, Germany) Morphometric analysis of ... T, Courtney MJ & Coffey ET (2005) Constitutively active cytoplasmic c- Jun N-terminal kinase is a dominant regulator of dendritic architecture: role of microtubule-associated protein as an effector...

Ngày tải lên: 14/02/2014, 19:20

... activation of a family of cytosolic cysteine proteases, caspases, which are required for many of the morphological changes that occur during apoptosis The mitochondrial release of cytochrome c ... membranes, which liberates cytochrome c and activates caspase and the apoptosome [23] Transfection of tBid directly triggers mitochondrial-dependent apoptosis and caspase activation [17] Because Itch overexpression ... final concentration of 1% Extracts were incubated for 20 at C and centrifuged at 18 000 g in a microcentrifuge at C For immunoprecipitation assays, extracts of transfected cells were immunprecipitated...

Ngày tải lên: 16/02/2014, 09:20

... constitutions generally In democratic countries, constitutional structures concern the competition between the collective goals of the community and ideas of individual equality and freedom Constitutional ... Criminal Justice Act 1988 103 Criminal Justice (International Co-operation) Act 1990 537 Criminal Justice (Terrorism and Conspiracy) Act 1998 435, 437 Criminal Justice and Police Act 2001 346, ... Table of Statutes Access to Justice Act 1999 113 Access to Personal Files Act 1987 551 Act of Settlement 1701 66, 125, 244, 292 Act of the Union of Wales 1536 160 Act of Union with Ireland 1800...

Ngày tải lên: 18/02/2014, 05:20

... triplicate Subcellular location of STAT1 determined by fluorescence microscopy: (B) cytoplasmic location of STAT1 in untreated cells and nuclear location in IFN -c treated cells (20 ngÆmL)1); (C) cytoplasmic ... STAT3-speci c or could also interact with STAT1 and disrupt its signalling In colorectal carcinoma cells, treatment with IFN -c sensitizes cells to cytotoxic compounds, and can also induce cell death ... cell death of the colon carcinoma SW480 cells To examine the transfection efficiency of hpST3dODN into cells, we applied different concentrations of the fluorescein isothiocyanate (FITC)-labelled...

Ngày tải lên: 18/02/2014, 08:20

... Supreme Court Activism, the Public Interest, and the Making of Constitutional Law l a r ry yac k l e the university of chicago press chicago and london larry yackle is professor of law and the ... the text of the historical document as the source of constitutional meaning and actually decides hard cases on the basis of pragmatic judgment This is perfectly clear in decisions implicating individual ... more practical He distinguishes between historical understandings of the practices that constitutional rights prohibited, on the one hand, and historical understandings of the practices that...

Ngày tải lên: 18/02/2014, 11:20

... TTT GTA CAA AAA AGC AGG CTA TCA TGC TGT TGT CAG GTC CCT CTC G; and reverse, GGG GAC CAC TTT GTA CAA GAA AGC TGG GTC AGT GGT GGT GGT GGT GGT GCA GAG GAG GGA TAT GGG GAA CGG CAA A The PCR reaction ... add EcoRI and KpnI restriction endonuclease sites to the 5¢ and 3¢ ends, respectively The primers used were as follows: forward primer, GTT GGA ATT CCA TCA TCA TCA TCA TCA TCA GGG CAC GAC ACA CAT ... CCC C; and reverse primer, GAT CGG TAC CTC ATT ACA GAG GAG GGA TAT GGG GAA C The PCR reaction was done as described above The amplified PCR product was inserted into the EcoRI and KpnI sites of...

Ngày tải lên: 19/02/2014, 06:20

... research, test and technically support advances in 3D HFR In March, Cameron worked with Christie and other technical partners to demonstrate a groundbreaking “proof of concept” screening of footage ... registered to ISO 9001 and ISO 14001 Performance specifications are typical Due to constant research, specifications are subject to change without notice Printed in Canada on recycled paper 3273 Mar ... advanced cinema technologies Our steady R&D and deep ties into the motion picture community have made Christie the “director’s choice” for the collaborative advancement of HFR display technology...

Ngày tải lên: 19/02/2014, 10:20

... CP-MAS 1 3C- NMR chemical shift values of ring and methyl carbons of native chitosan, LMWC and chito-oligomers Chemical shift values (p.p.m.) Sample CH3 C2 /C6 C3 /C5 C4 C1 -C O Chitosan LMWC (1 h) Chito-oligomers ... standards Circular Dichroism (CD) CD spectra for native chitosan and LMWC (5 mgÆmL)1 in 0.1 M perchloric acid; path length, cm) were recorded on a Jasco J-810 automatic recording spectropolarimeter, continuously ... sequence in chitosan is of four types, -GlcN-GlcN-, -GlcN-GlcNAc-, -GlcNAc-GlcNand -GlcNAc-GlcNAc-, of which the first is the major type and the last one results from the heterogeneous de-Nacetylation...

Ngày tải lên: 19/02/2014, 12:20