... with increasing percentages of TFE, which indicates that the helicity of the peptides increased within more hydrophobic environments The spectral change induced by the increased concentration of ... face, the nonpolar residues in the hydrophobic face of D16W-D24)37 GGN4 seem to contact the SDS micelles by hydrophobic interactions with the acyl chains of the micelles This possible interaction, ... also significantly increased the antimicrobial activity of the peptide However, a remarkable increase of the hemolytic activity was observed concomitantly Conformational preferences of the GGN4...
Ngày tải lên: 31/03/2014, 09:20
... enhance their collocational competence On the day of the lesson, the researcher brought a paperback version of the Oxford collocations dictionary for students of English and an electronic version ... overview of collocation, different aspects of collocation instruction and collocations in ESL writing 2.1 Overview of collocation 2.1.1 Definition of collocations Firth R.J is considered the first scholar ... on the screen in the form of a list of examples This list of examples is called a concordance A concordance can be utilized to find instances of authentic usage to demonstrate features of vocabulary,...
Ngày tải lên: 28/03/2015, 10:15
AN ACTION RESEARCH ON THE EFFECTS OF PRE WRITING ACTIVITIES ON THE GRADE – 11 NON – MAJOR ENGLISH STUDENTS’ MOTIVATION IN WRIT
... Introduction, Development and Conclusion Part 1: Introduction presents the rationale, the research questions, the method of study, the research procedure, the scope of the study, the significance of ... together in certain way, on a flat surface of some kind In conclusion, Byrne’s definition can be considered one of the most complete definitions of writing because it covers all of the features of ... to conduct an useful pre – lesson activity, a teacher needs not only knowledge of the language but also knowledge of content which means the knowledge of the topic they are going to conduct According...
Ngày tải lên: 07/09/2013, 13:58
THE EFFECTS OF THREE ORGANIC CHEMICALS ON THE UPPER THERMAL TOLERANCES OF FOUR FRESHWATER FISHES potx
... However, the nominal concentrations of the tests chemicals were presented in the result for this paper because each CTM test lasted for Ͻ31 only Acclimatization Before conducting the CTM tests, ... plastic screen was placed across the test aquarium to protect the fish from coming into direct contact with heating coils Fig The critical thermal maximum temperatures of four fish species to control ... water in the control aquaria contained no toxicants, although the chlorpyrifos, endosulfan, and phenol treatments contained the same concentration of toxicants used in the acclimation phase (Table...
Ngày tải lên: 14/03/2014, 20:20
Báo cáo khoa học: The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 pot
... CCACAGAAGGAGCAAATACTTC GTTTTGCAGTAGGCCACCAC AGGAGGAGGAGTGGTGCTG GTCCCCAGCAGCAGCAGTA GAGGTGAGCCGATGGAGATTTA CCTCTCAGGCGCTCAGCTTC TCTCCGGCGAGATGTCCGA GCTCCAGTGAATCCAGGTTG TCTCCGGCGAGATGTCCGA GGCAGCGATCACCAGTAAAC ... NRG-CRD_for NRG-CRD_rev NRG-5¢_for NRG-a_rev NRG-5¢_for NRG-Beta_rev GAPDH_for GAPDH_rev TGAAAGACCTTTCAAACCCCTC GTTTTGCAGTAGGCCACCAC GCCAGGGAAGTCAGAACTTC GTTTTGCAGTAGGCCACCAC CCACAGAAGGAGCAAATACTTC ... dilution : 500) (both Santa Cruz Biotechnology, Santa Cruz, CA, USA) for the detection of membrane bound NRG-1, anti-ADAM10 (Chemicon, Temecula, CA, USA; dilution : 1000) for the detection of the...
Ngày tải lên: 16/03/2014, 04:20
Báo cáo khoa học: Murine serum nucleases – contrasting effects of plasmin and heparin on the activities of DNase1 and DNase1-like 3 (DNase1l3) doc
... eliminated by EcoRI ⁄ NotI cleavage Cell transfection Cultivation of NIH-3T3 fibroblasts (ACC59) was performed according to the instructions of the German Collection of Microorganisms (Braunschweig, ... different concentrations of NaCl (0.3–2 m) Standard elution was performed with the concentration of m NaCl Subsequently, the samples were desalted and concentrated using Ultracel YM-10 MicroconÒ Centrifugal ... well as extravascular functions in vivo: (a) clearance of chromatin released into the circulation by dying cells to prevent occlusion of capillaries by DNA clots; (b) clearance of nuclear debris...
Ngày tải lên: 30/03/2014, 02:20
effects of recognition versus disclosure on the structure and financial reporting of share based payments
... This measure conveys an incomplete picture of the economic consequences of recognition because firms may increase other forms of compensation irrespective of changes in options, biasing the measure ... report changes to other terms of option contracts: the moneyness of options and the contractual length Where possible, I conduct the changes analysis for employees at different levels – the CEO, ... contracting, or compensation For example if investors’ perceptions of compensation costs are unchanged by recognition versus disclosure and contracting arrangements (including compensation contracts) are...
Ngày tải lên: 03/06/2014, 01:05
báo cáo hóa học: " e differential mediating effects of pain and depression on the physical and mental dimension of quality of life in Hong Kong Chinese adults" pptx
... the negative effects of pain on physical QoL The indirect effect of depression on the pain-QoL link pathway was 0.08, indicating that about 75% of the effect of pain on QoL impacted through the ... Yet, further investigation is needed to confirm the current prevalence estimate of chronic pain among professional teachers It should be noted that among the symptomatic subjects, 28.5% of them ... Kowloon Tong, Hong Kong 2Department of Social Work, Hong Kong Baptist University, Hong Kong 3Department of Community Medicine, The University of Hong Kong, Pokfulam, Hong Kong 13 14 Authors’ contributions...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo hóa học: " The effects of hypertonic fluid administration on the gene expression of inflammatory mediators in circulating leucocytes in patients with septic shock: a preliminary study" pptx
... This study is part of a trial that investigated the cardiovascular effects and the effects on gastric and sublingual microcirculation of hypertonic and isotonic resuscitation, which will be published ... the Ct and the efficiency of amplification could be used to adjust for significant difference in the starting concentration of mRNAs Specimens in which the RNA yield, quality, or amplification ... from the Waikato Medical Research Foundation (WMRF 127) Dr van Haren has no conflicts of interest to disclose Dr Pickkers has no conflicts of interest to disclose Mr Cursons has no conflicts of...
Ngày tải lên: 20/06/2014, 23:20
Báo cáo hóa học: " Effects of low-temperature capping on the optical properties of GaAs/AlGaAs quantum wells" doc
... difference in the optical qualities between the 200 C- capped sample and the others In the sample capped at 200 C, incorporation of excess arsenic followed by the formation of As clusters introduces ... [21] On the other hand, the quadratic (m = 2) development observed in the 200 C- capped sample is consistent with the fact that the nonradiative decay channels are strongly active in the capping ... significantly lower the quantum efficiency of the embedded nanostructure, even though the capping layer was grown at a low temperature with a normal condition Of course the quality of the capping...
Ngày tải lên: 21/06/2014, 06:20
Báo cáo khoa học: "Effects of cyclosporin A treatment on the pathogenesis of avian leukosis virus subgroup J infection in broiler chickens with Marek’s disease virus exposure" ppt
... Amplification and detection of specific products was undertaken by a Light Cycler (ROCHE Molecular Biochemicals, Indianapolis, IN) according to the manufacturers recommendations (ROCHE Light Cycler ... positive cells out of gated lymphocytes in any of the groups throughout the experiment CBH response The effect of CSP treatment on the CBH response was evaluated in chickens at weeks of age The CBH-1 ... by the T-cell receptor This especially affects the production of interleukin-2 (IL-2), hence T cell proliferation is affected [22,33] As a consequence IL-2 dependent functions which include Thelper...
Ngày tải lên: 07/08/2014, 17:22
Báo cáo lâm nghiệp: "Effects of a clear-cut on the in situ nitrogen mineralisation and the nitrogen cycle in a 67-year-old Douglas-fir (Pseudotsuga menziesii (Mirb.) Franco) plantation" potx
... clear-cut and the nitrogen cycle 4.3 Consequences of the harvest 4.3.1 Physical and chemical conditions of the soil Numerous authors have described changes in the physical and chemical status of forest ... significant changes after the clear-cut: (i) increase in organic carbon content on the soil surface which, combined with the organic N decrease, led to a small increase in C: N ratio of organic matter ... investigate the longterm effects of the harvest on the nitrogen cycle Key-points to better understand the effect of clear-cutting on forest ecosystem function and sustainability are (i) the role of soil...
Ngày tải lên: 08/08/2014, 01:21
Báo cáo khoa học: "Interactive effects of waterlogging and irradiance on the photosynthetic performance of seedlings from three oak species displaying different sensitivities (Quercus robur, Q petraea and Q rubra)" docx
... stomatal closure (no effects on photosynthetic capacity), while the latter seems no to be due to a combination of both stomatal closure and direct effects on photosynthetic carbon reduction cycles, ... according to Butlers model (Butler, 1978), as resulting from the onset of long lasting nonphotochemical fluorescence quenching, rather than of severe dysfunctions in photochemical reaction centres ... as compared to the two other species: similar declines of photochemical efficiency - were obtained with a smaller increase in in the for- non-photochemical quenching DISCUSSION on the photosynthetic...
Ngày tải lên: 08/08/2014, 18:21
Báo cáo khoa học: "The effects of different weaning modes on the endocrine stress respons" potx
... and Chronic Health Evaluation II scores from clinical data available after the first 24 hours of intensive care All patients received a nasojejunal tube, and feeding was commenced according to the ... immunoassay (ECLIA; Roche, Mannheim, Germany) VMA concentrations of spot urine samples (2-hour collection) were determined by chomatographic-spectrohotometric assay (FAR, Verona, Italy) Blood glucose ... ≥ 200, the resolution of (or significant improvement in) the underlying condition requiring mechanical ventilation, hemodynamic stability, an adequate neurological status, an absence of fever,...
Ngày tải lên: 12/08/2014, 20:20
THE INDIVIDUAL AND COMBINED EFFECTS OF EXERCISE AND COLLAGENASE ON THE RODENT ACHILLES TENDON
... a) Eccentric exercise The most conservative, and arguably the most effective, treatment option is eccentric exercise Eccentric exercise consists of lengthening the muscle-tendon unit and combines ... motion For motion to occur, the connective tissue components (ligaments and tendons) are essential To carry out this function, ligaments connect bone to bone and tendons connect muscle to bone ... unit Creep loading The application of a continuous force on an object Cyclical loading The application of a fluctuating force upon an object Cytokine Small, secreted proteins that function as...
Ngày tải lên: 24/08/2014, 09:15
A study on the effects of pre-listening activities on the listening performance of non-major 10th grade students at Nguyen Gia Thieu High school, Hanoi
... concept of listening comprehension 1.1.2 The process of listening comprehension 1.2 The concept of listening performance 4 4 1.3 Factors affecting students’ performance in ... affecting the choice of pre-listening activities 1.5 Related studies of the effects of pre-listening activities on listening performance Chapter Research Methodology 2.1 Situation ... performances of grade 10 students at Nguyen Gia Thieu high school The research involved the participation of 100 students and ten teachers answering the survey questionnaire Besides, the researcher conducted...
Ngày tải lên: 19/03/2015, 10:37
Effects of high glucose concentrations on the expression of genes involved in proliferation and cell fate specification of mouse embryonic neural stem cells
... the effect of high concentrations of glucose on the growth, survival, proliferation and cell-fate specification of NSCs isolated from the telencephalon of embryonic mice, and on the expression ... promote the differentiation of autonomic neurons and induce the expression of Ascl1 indicating that BMP2 and BMP4 control the specification of autonomic neurons through the induction of Ascl1 expression ... is the consequence of a deficiency of insulin action due to abnormalities at the cell surface or within the cell NIDDM patients have considerable preservation of the β-cell mass, which secretes...
Ngày tải lên: 30/09/2015, 06:36
The effects of planning with writing on the fluency, complexity, and accuracy of l2 oral narratives
... there is a consensus among speech production researchers on four important components of language production: conceptualization, formulation, articulation, and self-monitoring, among which conceptualization, ... assigning the right propositional shape to these chunks of information and deciding on matters such as what the topic or focus of the utterance will be The product of conceptualization is called the ... evidence to confirm the effects of pre-task planning on language accuracy and complexity in addition to fluency, further research has to be conducted to find a favorable planning condition in which...
Ngày tải lên: 12/05/2016, 16:06
Báo cáo sinh học: " Effects of pedigree errors on the efficiency of conservation decisions" pot
... where c OC is a vector of proportional contributions of (n) the observed optimum contribution vector ( c OC ) c OC was calculated by substituting F in Equation by the selection candidates to the next ... kinship of the current population, expressed on the scale of FGE NOC was calculated by substituting c in Equation with cOC, which is an optimum contribution vector that minimizes c' Fc, and therefore ... decreased NEC was calculated by substituting c in Equation with cEC, which is a vector of equal contributions per candidate parent, so that the sum of elements of cEC equals one NEC is simply the average...
Ngày tải lên: 14/08/2014, 13:21