c contrasting approaches to article xx and environmental measures

Slide an investigation into some approaches to vocabulary teaching and learning and the application of games in teaching and learning vocabulary at pre – intermediate level at foreign language center – haiphong university

Slide an investigation into some approaches to vocabulary teaching and learning and the application of games in teaching and learning vocabulary at pre – intermediate level at foreign language center – haiphong university

... Ineffective vocabulary learning 1.2.3 The status of vocabulary in current language teaching and learning 1.3 Approaches to language teaching and their relevance to vocabulary 1.4 Recent research ... Development Chapter one: Literature review 1.1 Vocabulary 1.2 Vocabulary in language teaching and learning 1.3 Approaches to language teaching and their relevance to vocabulary 1.4 Recent research about ... practice  Games encourage learners to interact and communicate with one another  Games can motivate learners by bringing fun to classes Games are highly motivating because they are amusing and...

Ngày tải lên: 29/01/2014, 14:36

29 1,4K 2
Tài liệu Báo cáo khoa học: Combinatorial approaches to protein stability and structure pdf

Tài liệu Báo cáo khoa học: Combinatorial approaches to protein stability and structure pdf

... were characterized, and all were helical, monomeric and stable NOESY, 15N-1H HSQC and 1 3C- 1H HSQC NMR spectra indicated that four of the five proteins had well-ordered and persistent main-chain and ... lytic phage; and lac repressor prevents transcription of b-galactosidase, which can be assayed by survival on lactose minimal medium or hydrolysis of a chromogenic galactoside The latter case illustrates ... linkage of nucleic acid encoding the protein to the protein itself (i.e linkage of genotype to phenotype), because even single molecules of nucleic acid can be amplified and then sequenced The two...

Ngày tải lên: 19/02/2014, 12:20

14 584 0
THEORETICAL AND METHODOLOGICAL APPROACHES TO SOCIAL SCIENCES AND KNOWLEDGE MANAGEMENT doc

THEORETICAL AND METHODOLOGICAL APPROACHES TO SOCIAL SCIENCES AND KNOWLEDGE MANAGEMENT doc

... this chapter, social sciences denote the set of social scientific branches (economics, sociology, etc.) while social science denotes the general concept abstracted from each of social sciences ... THEORETICAL AND METHODOLOGICAL APPROACHES TO SOCIAL SCIENCES AND KNOWLEDGE MANAGEMENT Edited by Asunción López-Varela Theoretical and Methodological Approaches to Social Sciences and Knowledge ... the economic rationalism validated the physicsmimicked economic theories Physics took the economy-mimicked view of nature and 36 Theoretical and Methodological Approaches to Social Sciences and...

Ngày tải lên: 29/06/2014, 09:21

407 836 0
Báo cáo sinh học: "Q&A: Quantitative approaches to planar polarity and tissue organization" pot

Báo cáo sinh học: "Q&A: Quantitative approaches to planar polarity and tissue organization" pot

... only a complex biological process that integrates basic cell biology, cell-cell communication and dynamic changes in cell and protein interactions over time, but it is also directly relevant to human ... all affect planar polarity measurements To account for differences in sample preparation and illumination settings, it is necessary to subtract the background fluorescence before calculating ... fluorescence Cell surface 100 Cytoplasm 3.0 Absolute values Relative fluorescence 120 Absolute fluorescence (c) (b) 2.5 2.0 1.5 1.0 15 30 45 60 75 90 Orientation (degrees) Background subtracted...

Ngày tải lên: 06/08/2014, 19:21

5 384 0
Báo cáo nghiên cứu khoa học " Development of Modeling System to Simulate Hydrodynamic and Environmental Quantities in the Hai Phong Estuary, Vietnam " pot

Báo cáo nghiên cứu khoa học " Development of Modeling System to Simulate Hydrodynamic and Environmental Quantities in the Hai Phong Estuary, Vietnam " pot

... / , where τ c and τ w are current and wave surface stress, respectively According to Grant and Madsen (1979) and WAMDI group (1988), these stresses are expressed as τ c = ρ Cc uc2 and τ w = κ2 ... where C z = material concentration, and c a = reference concentration The bed load transport rate q b depends on the critical velocity characterized by the sediment type and the total skin friction ... source, and D = deposition source at the bottom These source terms depend on the total skin friction shear velocity u*cw , sinking velocity ws , critical shear stress of resuspension u*ce , and critical...

Ngày tải lên: 09/08/2014, 18:20

8 297 0
Báo cáo khoa học: "Correlation of procalcitonin and C-reactive protein to inflammation, complications, and outcome during the intensive care unit course of multiple-trauma patients" pdf

Báo cáo khoa học: "Correlation of procalcitonin and C-reactive protein to inflammation, complications, and outcome during the intensive care unit course of multiple-trauma patients" pdf

... fractures according to accepted standards of care PCT, CRP, all clinical, microbiological, and laboratory data, and all diagnostic and therapeutic options were registered The data analyzed included ... data collected each day for days, and on days 14 and 21 of treatment in the ICU: PCT, CRP, clinical evi- dence and laboratory data of infection, microbiological findings, clinical suspicion of ... http://ccforum.com/content/10/1/R1 Figure and C- reactive protein maximum concentrations of procalcitonin (PCT) Histogram of the day of(CRP) in multiple-trauma patients and C- reactive protein (CRP)...

Ngày tải lên: 12/08/2014, 23:20

10 295 0
Some approaches to nonlinear modelling and prediction

Some approaches to nonlinear modelling and prediction

... and capability to model more complicated data structures 1.1.4 Piecewise Single-Index Model (pSIM) Following the direction of last subsection and given the efficiency of SIM, it is natural to consider ... medicine, economics and financial econometrics It is in the intersection of both the EDR approaches introduced above and the projection pursuit regression (PPR) approach proposed by Friedman and Stuetzle ... two decades a series of papers (Powell, Stock, and Stoker, 1989; H¨dle and Stoker, 1989; Ichimura, 1993; Klein and Spady, 1993; H¨rdle, Hall, and a a Ichimura, 1993; Sherman, 1994; Horowitz and...

Ngày tải lên: 10/09/2015, 09:24

163 323 0
Novel lipidomic approaches to analyse glycerophospholipids and sphingolipids in complex mixtures using mass spectrometry

Novel lipidomic approaches to analyse glycerophospholipids and sphingolipids in complex mixtures using mass spectrometry

... characteristic and specific for a class of lipids can be used for other MS experiments, such as multiple-reaction monitoring (MRM) and precursor ion scans (C) Precursor ion scans for lipids containing ... structurally diverse collection of molecules that vary in physicochemical properties and dynamic range, which poses a huge technical challenge to analysts Biochemical analytics of lipids have made ... to acknowledge the contribution of conventional methods, such as metabolic labelling and thin layer chromatography, as well as more advanced technologies such as nuclear magnetic resonance, and...

Ngày tải lên: 14/09/2015, 14:06

225 1,3K 0
Chemical proteomics approaches to study aspartic and metalloproteases

Chemical proteomics approaches to study aspartic and metalloproteases

... c Concentration (grams per milliliter) calcd Calculated o Degree Celsius C CD Circular dichroism Cy3 Cyanine dye δ Chemical shift d Doublet Da Dalton viii DCC N,N’-Dicyclohexylcarbodiimide DCM ... organic reactions that succinctly fall under the click chemistry umbrella, such as the Diels-Alder reaction, kinetically-driven carbonyl chemistry, addition to C- C multiple bonds and 10 nucleophilic ... RP-HPLC purification gave the desired products Cy3 Cy3-NHS a) D-Biotin Fmoc D-Biotin-NHS Fmoc Boc N H c) b) COOH N H N H COOH N H Fmoc-Lys(Cy3)-OH d) Fmoc-Lys(Boc)-OH Cy3 Fmoc N H N H Biotin COOH...

Ngày tải lên: 03/10/2015, 20:33

165 322 0
Evaluation of different approaches to protein engineering and modulation

Evaluation of different approaches to protein engineering and modulation

... reaction, using the following program, 94 C, min; 10 cycles of 94 C 15 sec; 55 C, 30 sec; min, 72 C and 15 cycles of 94 C, 15 sec; 55 C, 30 sec; + 20 sec/Cycle (cycle extension) 72 C, ... of each primer, µL of the 5X reaction buffer in a total of 20 µL reaction volume, and subjected to the following PCR program, 24 cycles of 96 C, 30 sec; 50 C, 15 sec; 60 C, 2.7 Site directed ... transpeptidation activity of SrtA To detect the hydrolysis activity of SrtA, it was incubated with a quenched fluorescent substrate (ACCLPETG-DABCYL), upon cleavage of the T-G bond, the fluorescence of ACC is...

Ngày tải lên: 05/10/2015, 22:04

125 552 0
Approaches to critical reading and writing

Approaches to critical reading and writing

... brief critical response  Keep note of bibliographic details Critical reading/ critical writing Handout – p 12-13 Wallace and Wray  As a critical reader, one evaluates the attempts of others to communicate ... become more self-aware of your own written work: – Sufficient evidence to back up claims; argumentation/reasoning; becoming alert to your assumptions and how they affect your claims  Wallace and ... communicate with and convince one's target audience – Wallace and Wray, 2006 Free writing  Way of using writing as a tool for thinking  Allows you to write without constraints To it – Write continuously,...

Ngày tải lên: 27/06/2016, 10:11

31 486 4
Tài liệu Community Approaches to Child Health in Malawi: Applying the Community Integrated Management of Childhood Illness (C-IMCI) Framework docx

Tài liệu Community Approaches to Child Health in Malawi: Applying the Community Integrated Management of Childhood Illness (C-IMCI) Framework docx

... partners carefully, and choose local MOH officers who are interested in C- IMCI programs 26 Community Approaches to Child Health in Malawi Additional sources “UNICEF C- IMCI Briefing package for facilitators” ... and reduce child mortality and morbidity The framework includes three categories of activities (called elements) and a multi-sectoral platform that focus on specific behaviors and practices of ... advance the effectiveness and scale of community-focused public health practices Established in 1997, CORE Group is a 501 (c) membership association based in Washington, DC that is comprised of citizen-supported...

Ngày tải lên: 12/02/2014, 12:20

33 556 0
Tài liệu Báo cáo khoa học: Association of mammalian sterile twenty kinases, Mst1 and Mst2, with hSalvador via C-terminal coiled-coil domains, leads to its stabilization and phosphorylation doc

Tài liệu Báo cáo khoa học: Association of mammalian sterile twenty kinases, Mst1 and Mst2, with hSalvador via C-terminal coiled-coil domains, leads to its stabilization and phosphorylation doc

... to the scaffold protein, connector enhancer of KSR1, CNK1, mediates the pro-apoptotic effects of a constitutively active Ras [15,25] Furthermore, Nore1 appears to direct recruitment of Mst1 to ... truncated mutants of flag-Sav cDNA or with HA-PPIA or flag-CrmA-DQMD cDNAs into 293T cells as indicated Two days after transfection the cells were washed and lysed Immune complexes and total cell ... the C- terminal coiled-coil domains of Sav and Hpo were also crucial and ⁄ or sufficient for their interaction [19,21,23] These results indicate that the coiled-coil interaction between Mst and...

Ngày tải lên: 19/02/2014, 06:20

13 321 0
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

... such long incubation times and high concentrations of mitoDC-81 cannot be used with isolated mitochondria due to uncoupling and loss of mitochondrial integrity Isolated mitochondria can be incubated ... nanomolar to micromolar concentrations of mitoDC-81 This high local concentration of mitoDC-81 within mitochondria could then lead to the alkylation and inactivation of mtDNA, as indicated in ... cation to DC-81 does not disrupt its ability to alkylate DNA and high micromolar concentrations of mitoDC-81 are sufficient to alkylate linear, circular and supercoiled DNA As these concentrations...

Ngày tải lên: 20/02/2014, 11:20

10 639 0
Continuing Challenges and Potential for Collaborative Approaches to Education Reform pot

Continuing Challenges and Potential for Collaborative Approaches to Education Reform pot

... data on school demographic characteristics, school performance indicators, 16 Continuing Challenges and Potential for Collaborative Approaches and community profiles to understand the changes ... Urban School Reform CERI Collaborating for Education Reform Initiative CPS Chicago Public Schools DCPS District of Columbia Public Schools DECCES Demonstrative District for the Systemic Change ... that central district offices lacked the ability to improve teaching and learning because central district offices Continuing Challenges and Potential for Collaborative Approaches • made poor choices...

Ngày tải lên: 06/03/2014, 01:22

125 594 0
Đề tài " Classical and modular approaches to exponential Diophantine equations I. Fibonacci and Lucas perfect powers " pdf

Đề tài " Classical and modular approaches to exponential Diophantine equations I. Fibonacci and Lucas perfect powers " pdf

... results Sections and are concerned with useful preliminaries Steps (i) and (ii) are treated in Sections and 6, respectively Sections and are devoted to step (iii) Sections and 10 are concerned with ... details are practically identical to the Fibonacci case Since the lower bound for p that we are trying to establish is much smaller in the Lucas case our program runs much faster, and completes the ... Full cubes in the Fibonacci sequence, Publ Math Debrecen 30 (1983), 117–127 [41] ——— , Perfect powers in second order recurrences, in Topics in Classical Number Theory, Vol I, II , Proc of the Conference...

Ngày tải lên: 06/03/2014, 08:21

51 397 0
Báo cáo khoa học: "Evaluating and Combining Approaches to Selectional Preference Acquisition" pptx

Báo cáo khoa học: "Evaluating and Combining Approaches to Selectional Preference Acquisition" pptx

... a corpus labeled explicitly with taxonomic information Lacking such a corpus we need to take into consideration the fact that words in a taxonomy may belong to more than one conceptual class Counts ... of concepts c' (where c' denotes the set of concepts dominated by c' , including c' itself) as a generalization for concept c (where c can be either n or one of its hypernyms): Initially, c' is ... , L„ , ec 13 (v1 [v,r ,c1 ,0 1-1cy l rrj (11) where [v, r, c] denotes the class chosen for concept c in relation r to verb v, P denotes a relative frequency estimate, and C the set of concepts in...

Ngày tải lên: 08/03/2014, 21:20

8 474 0
Complementary and Alternative Medicine for Older Adults A Guide to Holistic Approaches to Healthy Aging ppt

Complementary and Alternative Medicine for Older Adults A Guide to Holistic Approaches to Healthy Aging ppt

... of Anticancer Phytochemicals Phytochemical Actions Sources Carotenes Antioxidants Enhance immune functions Dark-colored vegetables such as carrots, squash, spinach, kale, tomatoes, yams, and sweet ... stress, etc.) and genetic influences can contribute to insulin resistance as the central characteristic that appears to cause a variety of cardiovascular risk factors Obesity, especially central obesity, ... Although diet can influence glucose tolerance, the relationships are more complex because it is well known that chronic stress can cause hippocampal atrophy and contribute to glucose intolerance Another...

Ngày tải lên: 15/03/2014, 09:20

344 512 0
Báo cáo khoa học: Structural features in the C-terminal region of the Sinorhizobium meliloti RmInt1 group II intron-encoded protein contribute to its maturase and intron ppt

Báo cáo khoa học: Structural features in the C-terminal region of the Sinorhizobium meliloti RmInt1 group II intron-encoded protein contribute to its maturase and intron ppt

... HPLC-purified primer WT (5¢-AATTGATCCCGCCCG CCTCGTTTTCATCGATGAGACCTGGACGAAGACGA ACATGGCGCCGCTGCGGGGC-3¢) using 50 lCi of [c- 32P]ATP (3000 CiÆmmol)1; GE Healthcare) and 100 units of T4 polynucleotide ... a template for amplification of a 70 bp PCR product with [5¢-32P]-labeled S70ds ⁄ UP (5¢-AATTGATCCCGCCCGCCTC-3¢) and S70ds ⁄ DN (5¢-GCCCCG CAGCGGCGCCATGTT-3¢) primers For PCR, we added 2.5 · 10)3 ... acids are colored according to properties: basic, blue (K, R and H); acidic, red (D and E); hydrophobic, green (P, L, I, V, M, F, W, Y and A); polar, purple (N, Q, S and T); and black (G and C) ...

Ngày tải lên: 15/03/2014, 09:20

11 398 0
w