c code for drive and directory navigation

Tài liệu Writing C Code for the 8051 pptx

Tài liệu Writing C Code for the 8051 pptx

... int code *)end; /* Now perform the checksum calculation, looping */ /* until the end of the range is reached */ while (codeptr

Ngày tải lên: 20/01/2014, 02:20

52 535 1
Tài liệu Making the Right Moves A Practical Guide to Scientifıc Management for Postdocs and New Faculty doc

Tài liệu Making the Right Moves A Practical Guide to Scientifıc Management for Postdocs and New Faculty doc

... magazine’s ScienceCareers.org Web site contains a Career Development resource for postdocs and beginning faculty (http://sciencecareers.sciencemag.org) The Chronicle of Higher Education’s online ... titles, and addresses and other contact information Invited keynotes and presentations Board certifications and eligibility for physician-scientists Two-Academic-Career Couples “Partner hire” packages, ... lasers and chemicals that have a high degree of acute toxicity and for disposing of hazardous chemical waste Your institution will have specific protocols and practices to follow for using lasers and...

Ngày tải lên: 21/02/2014, 12:20

267 616 0
Robert l  wood   c programming for scientists and engineers

Robert l wood c programming for scientists and engineers

... Standard Code for Information Interchange 8 C programming for scientists and engineers required Arrays and character strings are introduced in Sections 1.6 and 1.7, respectively Character data can ... in decimal or exponential formats, depending on the formatting codes that are used with fscanf and fprintf For the float data type the formatting code required for decimal format is %f and for ... that, the second reason for learning C is that C+ + is C with added functionality and that around 90% of any C+ + program is actually C The big difference between C and C + + is not so much in the...

Ngày tải lên: 19/03/2014, 14:13

151 1,3K 1
Developing C# Apps for iPhone and iPad using MonoTouch: iOS Apps Development for .NET Developers doc

Developing C# Apps for iPhone and iPad using MonoTouch: iOS Apps Development for .NET Developers doc

... to call Objective -C, C, and C+ +: MonoTouch harnesses all the power of low-level languages such as Objective -C, C, and C+ + You can use libraries written in Objective -C, et al from your MonoTouch ... application, including Pickers, Sliders, and Buttons, etc CHAPTER 1: Getting Started with MonoTouch You can also create your interface programmatically by instantiating Cocoa Touch objects and ... they can only write files to their own directory, and can read files from their directory and certain system directories They can’t, for instance, write to or read from any other application’s sandbox...

Ngày tải lên: 28/03/2014, 23:20

500 7,6K 0
Writing optimized c code for microcontroller applications

Writing optimized c code for microcontroller applications

... (_j),A Microcontroller Specific Optimization Every microcontroller has a specific instruction set The types of instructions vary according to the particular microcontroller The C compiler can generate ... development efficiency, many microcontroller based products are programmed in C Generally, when programs are written in C and compiled by a C compiler, the code efficiency decreases compared to an ... Specific Optimization PROGRAMMING GUIDELINES FOR EFFICIENT C CODE It is important to choose a good optimizing C compiler for your microcontroller project However, besides relying on the C compiler,...

Ngày tải lên: 08/03/2016, 11:39

21 443 0
iec 60298 a.c. metal-enclosed switchgear and controlgear for rated voltages above 1 kv and up to

iec 60298 a.c. metal-enclosed switchgear and controlgear for rated voltages above 1 kv and up to

... A .C metal-enclosed switchgear and controlgear for rated voltages above1 kV and up to and including 52 kV CODE PRIX PRICE CODE MenuyHapoaHaR 3netmOrexn~recnan HOMMCCUR Commission Electrotechnique ... Etablissement et coupure de charge inductive 947-5-1 (1990) Part 5: Control circuit devices switching and elements - section One: Electromechanical c~ atrol circuit devices Amendment (1994) and 947-5-Z(1992) ... withstand current and the rated peak withstand current of a main circuit cannot exceed the corresponding rated values of the weakestof its series connected components However, for each circuit or compartment,...

Ngày tải lên: 25/12/2013, 10:57

139 465 0
Tài liệu Debugging C and C++ code in a Unix environment ppt

Tài liệu Debugging C and C++ code in a Unix environment ppt

... the previous section Another tool is Checker The Checker tool uses it’s own version of gcc, checkergcc to include boundary checks in your code It is probably better than Electric Fence, but less ... allocation debugging tools As discussed earlier in the section called C and C+ + speci c problems, one of the causes of problems with C and C+ + code, is the policy of requiring explicit allocation ... ‘RTFM’) comes from Unix hackerdom; see [JARGON] if you are interested in it Chapter Aspects of debugging C and C+ + code Debugging C and C+ + code entails noticing, localising, understanding and repairing...

Ngày tải lên: 21/01/2014, 06:20

29 466 1
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products were cloned into the EcoRV site ... pseudo-pregnant MCH:ICR female mice Chimeric male mice were then crossed with B6 female mice T26 transgenic mice were back-crossed five times or more with B6 mice and used for analysis For genotyping, PCR and ... the complicated relationship between ECs and non-ECs such as mural, hematopoietic and mesenchymal fibroblast cells, even though a conditional genetic modification such as endothelium-speci c knockouts...

Ngày tải lên: 18/02/2014, 17:20

11 873 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

... liver cirrhosis and a type of liver cancer, hepatocellular carcinoma (HCC) The prevention of chronic hepatitis B and chronic hepatitis C prevents the majority of HCC cases because HBV and HCV are ... develop a vaccine for hepatitis C, which could substantially enhance hepatitis C prevention efforts The committee recognizes the need for a safe, effective, and affordable hepatitis C vaccine and offers ... chronic hepatitis B and chronic hepatitis C prevents the majority of HCC cases because HBV and HCV are the leading causes of this type of cancer Although the incidence of acute HBV infection is declining...

Ngày tải lên: 06/03/2014, 01:20

191 458 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc

... prevention coordinators CDC CHIP CI CIA CMS Centers for Disease Control and Prevention Children’s Health Insurance Program confidence interval enhanced chemiluminescence Centers for Medicare and Medicaid ... B and chronic hepatitis C are serious and can result in liver cirrhosis and a type of liver cancer, hepatocellular carcinoma (HCC) The prevention of chronic hepatitis B and chronic hepatitis C ... important risk factors for HCC are chronic HBV and HCV infections As stated above, an estimated 78% of HCC cases and 57% of liver cirrhosis cases are caused by chronic HBV and HCV infections (Perz...

Ngày tải lên: 06/03/2014, 01:20

253 370 0
Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx

Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx

... 5¢-TTCGA GGCCCGCGCCGCAATTGGGGGCCCAGAA-3¢ and 5¢TTCTGGGCCCCCAATTGCGGCGCGGGCCTCGAA-3¢ for E190A, 5¢-ATTCCGGTTACTTTCGCGGCCCGCGC CCAAATT-3¢ and 5¢-AATTTGGGCGCGGGCCGCGA AAGTAACCGGAAT-3¢ for E190A, 5¢-CAAATTGGGGG ... CCCAGCAGCTGGGAAGTCTGAA-3¢ and 5¢-TTCAGA CTTCCCAGCTGCTGGGCCCCCAATTTG-3¢ for E199A, and 5¢-GAAGCTGGGAAGTCTGCACAGTCTGGAGCC AAG-3¢ and 5¢-CTTGGCTCCAGACTGTGCAGACTTCC CAGCTTC-3¢ for E204A Mutated codons ... primers 5¢-TCTCGGAGATCC GACAGA-3¢ and 5¢-CTTTCGGGCTTTGTTAGCAG-3¢, respectively CD spectra were acquired on a J-810 spectropolarimeter (Jasco, Tokyo, Japan) with an attached Peltier temperaturecontrolled...

Ngày tải lên: 07/03/2014, 04:20

14 417 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... late-endosome ⁄ vacuole Traf c 2, 622–630 Piper RC, Cooper AA, Yang H & Stevens TH (1995) VPS27 controls vacuolar and endocytic traf c through a prevacuolar compartment in Saccharomyces cerevisiae J Cell ... requirement for the conserved RDF sequence for assembly and activity can be overcome by addition of Vta1p and a second Vps4p molecule with an intact C- terminal helix We also find evidence for the co-evolution...

Ngày tải lên: 07/03/2014, 05:20

23 491 0
A Concise History and Directory of the City of Norwich for 1811 pptx

A Concise History and Directory of the City of Norwich for 1811 pptx

... A Concise History and Directory of the City by C Berry A CONCISE HISTORY AND DIRECTORY OF THE CITY OF NORWICH; For 1811: Containing besides the LISTS, A VARIETY OF LOCAL INFORMATION, USEFUL and ... Manufacturers, Jail hill 50 A Concise History and Directory of the City by C Berry Coward Rob Publican, Tombland Fleece Coxton Henry, Publican, Market plain Two-necked Swan Cozens and Copeman, Grocers, ... brought for sale, 1s each; for stalls, 6d each; for every auction, 1s.; for calves and mules, 1d each Here also is the weighbridge for Hay, &c. , Mr C Hubbard, hay-weigher, and collector of the cattle-market...

Ngày tải lên: 08/03/2014, 00:20

116 532 0
Ecient Collision Detection for Animation and RoboticsMing C. LinDepartment of Electrical pptx

Ecient Collision Detection for Animation and RoboticsMing C. LinDepartment of Electrical pptx

... Chieh Lin i Abstract E cient Collision Detection for Animation and Robotics by Ming Chieh Lin Doctor of Philosophy in Electrical Engineering and Computer Science University of California at Berkeley ... described in Chapter In Chapter 4, we will discuss how we can use the incremental distance computation algorithm in Chapter for dynamic collision detection between non-convex polytopes and objects ... between convex polytopes described in Chapter and local numerical methods to extend the incremental nature to convex curved objects This approach preserves the coherence between successive motions and...

Ngày tải lên: 14/03/2014, 14:20

159 296 0
Báo cáo khoa học: Specific biomarkers for stochastic division patterns and starvation-induced quiescence under limited glucose levels in fission yeast docx

Báo cáo khoa học: Specific biomarkers for stochastic division patterns and starvation-induced quiescence under limited glucose levels in fission yeast docx

... high concentration of glucose in the blood [3] The fission yeast Schizosaccharomyces pombe is an excellent model eukaryote [4–6] for a number of cell biologic issues, such as cell division cycle control ... fasting condition Certain biosynthetic precursor compounds, such as UDP-glucose, acetyl-CoA and phosphoglyceric acid, were virtually absent in mm glucose, like ATP and other high-energy compounds, ... higher glucose concentrations In contrast, the CDP-bound lipid components, CDP-choline and CDP-ethanolamine (precursors for phosphatidylcholine and phosphatidylethanolamine, respectively), increased...

Ngày tải lên: 14/03/2014, 23:20

17 272 0
Báo cáo khoa học: Selective modulation of protein C affinity for EPCR and phospholipids by Gla domain mutation pdf

Báo cáo khoa học: Selective modulation of protein C affinity for EPCR and phospholipids by Gla domain mutation pdf

... phospholipid surfaces [16,26,27] and is therefore crucial for its activity The crystal structures of recombinant sEPCR, and sEPCR in complex with the Gla domain of protein C, have recently been solved ... injected across the flow cell of a CM5 sensor chip coated with RCR-2 sEPCR was injected for at a flow rate of 10 lLÆmin)1 and equilibrated for 10 2, Increasing concentrations of plasma protein C ... procedures) A nonreactive mAb was used as a control for nonspeci c binding in the reference flow cell Increasing concentrations of wild-type sEPCR (13–106 nM) were injected across both flow cells...

Ngày tải lên: 16/03/2014, 18:20

12 409 0
 c++ for engineers and scientists

c++ for engineers and scientists

... analysis for selecting correct conversion factors, consider converting days to seconds You can determine the correct form of each conversion factor easily by including the units with each conversion ... precedence, ASCII character codes, floating-point number storage, and command-line arguments Additionally, Course Technology provides tutorials for using various C+ + compilers at www.cengage.com/coursetechnology ... additional topics they introduce to the class Source Code The source code for this book is available at www.cengage.com/coursetechnology and is also available on the Teaching Tools CD Solution Files...

Ngày tải lên: 19/03/2014, 14:07

849 876 3
Báo cáo "Monte carlo simulation by code of MCNP and experimental check for measuring thickness of materials for the specializing system of MYO-101 " ppt

Báo cáo "Monte carlo simulation by code of MCNP and experimental check for measuring thickness of materials for the specializing system of MYO-101 " ppt

... Detection, First edition, Academic Press Inc, Published by Elsevier (2007) I.F Briesmeister, Ed., MCNP 4C2 - Monte Carlo N-Particle Transport Code System, CCC-701 (2001) Gordon R.Gilmore, Practical ... data and the calculated ones by MCNP, it could be found out conversion coefficients (ratios) for mass absolution coefficient of µ from the experiments to MCNP for the system of MYO-101 are indicated ... 2, where I is pulse count rate (cps) and x is mass thickness (g/cm2) Graphs that describe dependence between counting rate and mass thickness are shown in Figure 5, 6, 7, and for white paper, yellow...

Ngày tải lên: 22/03/2014, 11:20

7 467 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C pdf

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C pdf

... to expand and enhance the capacity to identify chronically infected pregnant women and provide case-management services, including referral for appropriate medical management For incarcerated ... hepatitis B vaccine has been effective in the reduction of new HBV infections CDC’s Advisory Committee on Immunization Practices (ACIP), which provides recommendations on the control of vaccine-preventable ... should expand services to reduce the harm caused by chronic hepatitis B and hepatitis C The services should include testing to detect infection, counseling to reduce alcohol use and secondary transmission,...

Ngày tải lên: 22/03/2014, 17:20

4 405 1
Báo cáo khoa học: "FSA: An Efficient and Flexible C++ Toolkit for Finite State Automata Using On-Demand Computation" ppt

Báo cáo khoa học: "FSA: An Efficient and Flexible C++ Toolkit for Finite State Automata Using On-Demand Computation" ppt

... depth-first search (DFS), single-source shortest path (SSSP), connect (only keep accessible and coaccessible state), strongly connected components (SCCs) • operations on relations of sets compose (filtered), ... SWIG interface generator (Beazley et al., 1996) and enables rapid development of larger applications without lengthy compilation of C+ + code The command-line interface comes handy for quickly applying ... Int Conf on Acoustics, Speech, and Signal Processing, pp , Hong Kong, China, April 2003 Srinivas Bangalore and Giuseppe Riccardi, 2000, Stochastic Finite-State models for Spoken Language Machine...

Ngày tải lên: 23/03/2014, 19:20

8 423 0
w