c class library application to host the serviced component

... were forced to chain successive equations at the different scales, accumulating statistical errors at each step To calculate these errors, it would need further consequent studies to solve complex ... of branch shape using a circle arc: this regular shape drifted the central part of the branch towards the shell of the crown and consequently pulled leaf area away from the centre of the crown ... crown) Polycyclism code is defined as A = first cycle of the year, all = all cycles mixed Numbers in parenthesis indicate the asymptotic standard error on the estimate Stand Needle age Polycyclism...

Ngày tải lên: 08/08/2014, 14:21

... Boost.Crc The Crc library provides calculations of cyclic redundancy codes (CRC), a commonly used checksum type A CRC is attached to a stream of data (from which it is computed), so the checksum can ... later to validate the data The library includes four sample CRC types: crc_16_type, crc_ccitt_type, crc_xmodem_type, and crc_32_type5 The author of Crc is Daryle Walker Boost.Date_time The Date_time ... shared_ptr r The reference count of the shared_ptr is unchanged This constructor never throws ~weak_ptr(); The weak_ptr destructor, similarly to the constructor, does not change the reference count...

Ngày tải lên: 20/06/2016, 14:45

... GTTAGCTACGGCACTAAAAGG CCGTCATCTACWCAGGGTATTAAC CCCTCTGCCAAACTCCAG GTTAGCTACGGCACTAAAAGG GCTGCCTCCCGTAGGAGT GCAGCCACCCGTAGGTGT GCTGCCACCCGTAGGTGT Reference Lane (1991) Lane (1991) This study This study Crocetti ... Candidatus ‘Accumulibacter phosphatis’ Most eubacteria Planctomycetales Verrucomicrobiales Sequence (5'!3') AGAGTTTGATCCTGGCTCAG GGCTACCTTGTTACGACTT CTGGAGTTTGGCAGAGGG GTTAGCTACGGCACTAAAAGG CCGTCATCTACWCAGGGTATTAAC ... Most eubacteria Most eubacteria, archaebacteria Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’...

Ngày tải lên: 05/09/2013, 09:38

... that consumers cannot be efficient in their choices and 19 that neoclassical economics failed to provide sufficient explanation of consumption processes A different approach to the consumer decision ... evaluating consumer willingness -to- pay and willingness -to- accept Incorporation of economic methods into customer acceptance and satisfaction techniques could greatly contribute to this line of research ... consumption The studies are concerned with 24 what the environmental consequences of consumer purchasing decision could be, how they can be influenced to reduce the associated impact with economic methods,...

Ngày tải lên: 04/11/2013, 10:15

... Interactor: In the CLT class, most of time is devoted to studentstudent interaction and students are expected to interact primarily with each other rather than with the teacher - Communicator: The ... main tendencies called Vygoskyan theory or sociocultural theory and the interactional modification theory 1.1.2.1 Interactional Modification Theory The first theory is much concerned with the role ... Participants included in an interaction can be either the effect–causer or the effect–receiver Effects are balanced for every participant Human interaction is a particular type of interaction Crystal...

Ngày tải lên: 18/12/2013, 21:39

... giới khiến s c cầu suy giảm, giá nhiều hàng hóa xuống m c thấp, lạm phát nư c khống chế Sau c ng bố CPI tháng 12 tăng m c 1,38% so với tháng trư c, Tổng c c Thống kê c ng bố CPI nư c nư c năm 2009 ... chủ yếu đạo th c kế hoạch kinh tế ngân sách năm 2008: Đề m c tiêu th c t c độ tăng trưởng 8.5% - 9% th c 10 biện pháp lớn nhằm c i thiện tình hình đầu tư kinh doanh, tích c c thu hút vốn nư c ... thuật l c dầu hạn chế nên chủ yếu phải nhập nhiều dầu thành phẩm, chiếm tỷ trọng cao kim ngạch nhập Nếu giả định t c độ cung tiền không tăng giá giới tăng, giá nư c tăng s c mua c khả to n giảm...

Ngày tải lên: 20/01/2014, 08:20

Ngày tải lên: 13/02/2014, 12:20

... 4: General Concepts describes the fundamental library concepts that you need to understand to work with all the components In particular, the chapter introduces the namespace std, the format ... Chapter 18: Concurrency describes the features provided by the C+ + standard library to enable and support concurrency and multithreading • Chapter 19: Allocators describes the concept of different ... of the elements in the vector (which sometimes also might be useful) This means that to avoid calling the copy constructor and the destructor for each element, you should usually declare the current...

Ngày tải lên: 17/02/2014, 22:20

... household specific characteristics employed to explain the choice of the wastewater treatment programme alternative, and the vector of coefficients to l are attached to the vector of interaction terms ... that the choice experiment method can be successfully employed in a developing country context with careful construction of the choice sets and effective field data collection There were some challenges ... goods themselves but from the attributes they provide According to the random utility theory, the utility of a choice is comprised of a deterministic component (V) and an error component (e), which...

Ngày tải lên: 18/02/2014, 01:20

... part of the glycine-rich stretch, but not the conserved hydrophobic domain or the second polyglycine stretch, was found to be necessary for correctly targeting the pea Toc75 protein to the outer ... peptide of Toc75 A J Baldwin and K Inoue Fig The biogenesis of pea Toc75 The precursor, intermediate, and mature forms of Toc75 are indicated as prToc75, iToc75, and mToc75 with the numbers of the N-terminal ... that directs the protein to the stroma Potential candidates for this component include a subunit of Toc complex such as Toc12 [23], a Hsp70 homolog in the intermembrane space of the chloroplast...

Ngày tải lên: 19/02/2014, 07:20

... the Nichigai dictionary, but decreased the accuracy However, by combining both resources, the accuracy was noticeably improved, and the coverage was comparable with that for the Nichigai dictionary ... quadruplechoice, in case the system cannot answer the question, random choice can be performed to improve the coverage to 100% Thus, for each knowledge resource we compared cases without/with random choice, ... dictionary On the other hand, in the case where random choice was performed, the Nichigai dictionary and the Webbased encyclopedia were comparable in terms of both the coverage and accuracy Additionally,...

Ngày tải lên: 20/02/2014, 18:20

... of the MUC5AC sequence With use of the primer pair 5¢-TATTCTAGAG AAGAGGGCCT GGTGTGCCGG AACCAGGACC AGCAGGGACC CTTCAAG-3¢ (GH262) and 5¢-ACGCGCTAGC TCAATGATGA TGATGATGGT GCATGGGGGA CACTGGGACG CC-3¢ ... a cDNA clone corresponding to the 3¢-end of human MUC5AC inserted into a pBluescript vector, was used as a template for PCR With use of the primer pair 5¢-GCTTCTAGAC ACGAGAAGAC AACCC ACTCC C- 3¢ ... in the 3¢-end of the PCR product The PCR product was ligated into the XbaI site of the previously described pSM vector [26] This vector is based on the pEGFP -C1 vector (Clontech, Palo Alto, CA,...

Ngày tải lên: 07/03/2014, 05:20

... MARGINAL EXTERNALAIR POLLUFION COSTS (BF 19891Car-km) IF THE ADDITIONAL KM IS DRIVEN BY A CAR OFTYPE Gasaline car P PRE-EEC cc c 1.4 1.4cccc2 cc>2 cc>2 LPG car NOTE: The calculabon of h e manglml exlernal ... frequency of shipment The authors estimated the effect of a percentage change in each of these characteristics on the respondent's utility By applying the ratio between the time and the cost coefficient ... costs only takes into account the effect on the fuel costs of gasoline cars Nevertheless, it can be expected that the importance of the marginal fuel costs will remaln small even if the effect...

Ngày tải lên: 07/03/2014, 11:20

... 47 Acetoac-CoA + NADPH fi 3HB-CoA + NADP 48 3HB-CoA fi PHB + CoA 49 PHB fi 3HB 50 Acetoac + NADH fi 3HB + NAD 51 Acetoac-CoA + Succ fi acetoac + Succ-CoA 52 Crot-CoA fi 3HB-CoA 53 L3HB-CoA fi crot-CoA ... Iso -C + NADP 26 a-KG + NAD + CoA fi Succ-CoA + NADH + CO2 27 Succ + GTP + CoA fi Succ-CoA + GDP 28 Succ-CoA fi Succ + CoA 29 Succ + FAD-S fi Fum + FADH-S 30 Fum fi malate Gluconeogenesis & pentose ... dehydrogenase Acetoacetate-succinyl-CoA transferase D-crotonase L-crotonase Acetoacetyl-CoA reductase (NADH) Crotonyl-CoA reductase Unknown pathway Propionyl-CoA carboxylase Methylmalonyl-CoA mutase...

Ngày tải lên: 07/03/2014, 15:20

... more speci c topic than the current query The user proceeds in the exploration of the document set by selecting speci c documents (to read them) or by selecting speci c facets, to refine the result ... propositions, which focuses on the statements expressed in the documents, can contribute to the exploration field and improve information access Our current application to the health-care domain relies ... exploration scheme 3.1 System Inputs Corpus A collection of documents, which form the search space of the system Extracted Propositions A set of propositions, extracted from the corpus document The propositions...

Ngày tải lên: 07/03/2014, 18:20

... structures [21–23] By molecular mechanics calculations the conformers of Ac-HGly-NHMe, Ac-b2-HAla-NHMe and Ac-b3-HAlaNHMe have been generated and compared to the canonical structures of the corresponding ... their resistance to enzymatic degradation, their affinity for the human NK-1 receptor and their potency to stimulate adenylate cyclase and phospholipase C (PLC) in CHO cells transfected with the ... G.M., Gatos, M., Graci, L., Formaggio, F., Crisma, M & Toniolo, C (2000) Conformational restriction through Ca · Ca i i cyclization: Ac1 2c, the largest cycloaliphatic Ca,a-disubstituted glycine...

Ngày tải lên: 08/03/2014, 08:20

... substrate concentrations of As hyperaccumulators and Astolerant plants The biological absorption coefficients (BAC, defined as the total element concentration in shoots with respect to total element concentration ... continuous phytoextraction (using hyperaccumulator plants) and induced phytoextraction (chemically induced accumulation of metals to crop plants) Induced phytoextraction has not yet been applied to As ... Phytoextraction Phytoextraction is the use of pollutant-accumulating plants which are able to extract and translocate pollutants to the harvestable parts Phytoextraction can be divided in continuous...

Ngày tải lên: 15/03/2014, 23:49

... 5¢-TGGGGGATGGAGGGTAAGACCATACACTT-3¢ 5¢-TTCTATAACGGAACATTATACCAACAAGG-3¢ 5¢-CAACATTTACCTGGGGCAGGTGGGTTCAG-3¢ 5¢-AATCCAAAAGTGCAGGCCTCACTAGCAGC-3¢ 5¢-TTGCCGACTAATTCCGGGACTCCATCATC-3¢ 5¢-CCGTCTTGCCAGAGTTTCTCCACCTCCTC-3¢ ... 5¢-GTCGTCAACAACGATCCTGACGTTGGGGA-3¢ 5¢-TACTGTCTTCTGCTAAACGCCAC-3¢ 5¢-GTCGTGATATTGAGGTGCCAGCC-3¢ 5¢-GCCCAGACGGGAAAATGCGTGTG-3¢ 5¢-CAGTTACACGATGCTTTGGCGCA-3¢ 5¢-GGAATAGATCTTGGAACCACATA-3¢ 5¢-TTGCCAAGATATGCTTCTGCAGT-3¢ ... )c, 0 ns ns ns )c +c, 0 +c ns +c +c +c ns ns ns ns ns )c )c )c, 0 )c, 0 )c, 0 ns ns +c +c ns ns )c )c, 0 ns +c )c, 0 ns )c, 0 )c ns ns ns ns ns )c +c, 0 ns ns +0 ns +c )c, 0 )c ns )c, 0 ns ns ) Significant...

Ngày tải lên: 16/03/2014, 23:20

... forms trivectors (volumes) with vectors perpendicular to it The trivector 1^ 2^ commutes with all vectors, and hence with all multivectors The trivector (pseudoscalar) also has the algebraic property ... example, consider rotating the unit vector a into another unit vector b, leaving all vectors perpendicular to a and b unchanged This is accomplished by a re ection perpendicular to the unit vector ... applications of geometric calculus The essential techniques are described in Chapter 5, which introduces the concept of the multivector derivative 18, 24] The multivector derivative is the natural...

Ngày tải lên: 17/03/2014, 14:29

... hide the implicit copy constructor If the type matches exactly, the implicit copy constructor is generated and called For example: template class MyClass { public: //copy constructor ... the standard exception classes Header Files for Exception Classes The base class exception and class bad_exception are defined in Class bad_alloc is defined in Classes bad_cast ... important consequences: The copy constructor and assignment operator of auto_ptrs "transfer ownership" of the objects to which they refer Consider, for example, the following use of the copy constructor:...

Ngày tải lên: 19/03/2014, 14:11