c and d may be covered by one or several csas as appropriate
Báo cáo y học: "The association of meat intake and the risk of type 2 diabetes may be modified by body weight"
Ngày tải lên :
31/10/2012, 16:49
... addition, advanced glycation and lipo-oxidation end products formed in meat and high fat products through heating and processing have been associated with insulin resistance in mice [24] and ... chronic diseases at baseline: coronary heart disease (CHD), stroke, and cancer and repeated the analyses after exclusion of subjects with these chronic diseases Tests for trend were performed ... did not consume processed meats The Cox proportional hazards model was used to assess the effect of meat intake on the incidence of type DM Socio-demographic factors and other risk factors for...
- 8
- 701
- 0
Báo cáo khoa học: Unique ganglioside binding by botulinum neurotoxins C and D-SA pdf
Ngày tải lên :
22/03/2014, 15:21
... HCR ⁄ C and HCR ⁄ D, but lacking a Trp Fig GBLs of HCR ⁄ C, HCR ⁄ D and HCR ⁄ D- SA overlaid with HCR ⁄ A and HCR ⁄ B HCR ⁄ D- SA (blue, upper) includes the conserved Phe1280 and Trp1282 (black), ... ⁄ C, BoNT ⁄ D, and BoNT ⁄ A By use of HCR ⁄ A and the corresponding amino acid residues, the main chain can be traced From the C- terminus, the main chain of the HCRs proceeds from a conserved ... review will describe the history and our current understanding of the entry of BoNT ⁄ C and BoNT ⁄ D into neurons BoNT ⁄ C and BoNT ⁄ D BoNT ⁄ C and BoNT ⁄ D are not typically associated with human...
- 11
- 360
- 0
Báo cáo khoa học: ADPase activity of recombinantly expressed thermotolerant ATPases may be caused by ppt
Ngày tải lên :
16/03/2014, 04:20
... and disrupted by sonication as previously described [21] Lysate was cleared by centrifugation at 100 000 g for 45 at C, incubated at 70 C for 30 min, and recleared by centrifugation as before ... NtrC1 ATPase and adenylate kinase ADP hydrolysis was clearly stimulated by a factor that was copurified in the NtrC1Cshort-his6 ATPase Q-fraction The Q-fractions of purified ATPase-deficient NtrC 1C ... Corp., New York, NY, USA) Recovered nucleotides were identified and quantified by anion exchange chromatography and UV spectroscopy, using known nucleotides as standards (Sigma-Aldrich Corp., St Louis,...
- 9
- 401
- 0
Báo cáo khoa học: "Septic shock is correlated with asymmetrical dimethyl arginine levels, which may be influenced by a polymorphism in the dimethylarginine dimethylaminohydrolase II gene: a prospective observational study" docx
Ngày tải lên :
13/08/2014, 03:20
... Locus DDAHII-449 Primer Allele GAAGGTGACCAAGTTCATGCTGACTGGAAGTCCAGCCCGG Allele GAAGGTCGGAGTCAACGGATTGACTGGAAGTCCAGCCCGC Common CCAGCTTTCTCCTTCTGTCCCATAA Table Demographics and asymmetrical dimethyl ... and SOFA score was entirely attributable to cardiovascular failure, a non-cardiac organ failure score was obtained by excluding the cardiovascular component from the total SOFA score There was ... and day ICU by Wilcoxon signed rank test; p = 0.001 score and ADMA levels were directly correlated on day (r2 = 0.23, n = 35, p = 0.002) The non-cardiac organ failure score was calculated as...
- 7
- 265
- 0
Strategic environmental assessments may be used to compare different energy scenarios, and a more sustainable power plan can be developed by incorporating the wider impacts considered during the assessment process
Ngày tải lên :
08/09/2015, 23:32
... reflected Such variation has been addressed by incorporating sufficient reserve capacity in the form of open cycle gas plants that can be readily switched on and off to compensate for fluctuations ... Pollution, land and biodiversity, and rivers are components under the ecological “security aspect.” The aspect of good governance and state security is not included in the diagram, because no measurable ... Pollution, land and biodiversity, and rivers are components under the ecological “security aspect.” The aspect of good governance and state security is not included in the diagram, because no measurable...
- 50
- 456
- 0
the method of investment appraisal which may be applied to evaluated and rank potential investment opportunities and their relative merits and limitations
Ngày tải lên :
17/02/2014, 13:02
... much as cash today PP also ignores all cash flow that occurs after the payback period is reached or in other word, PP does not consider post-payback cash flows and time value of money In addition, ... NPV and IRR method (possible decision conflicts) An accept/reject ‘conflict’ occurs when NPV says ‘accept’ and IRR says ‘reject’ or NPV says ‘ reject’ and IRR says ‘accept’ When projects are independent, ... may not be wise to mix business with personal life Hence, be careful and make sure terms are clear and documented before proceeding with borrowing from friends and relatives • Bonds and debentures...
- 17
- 575
- 0
Tài liệu Báo cáo khoa học: Proteolysis of Pseudomonas exotoxin A within hepatic endosomes by cathepsins B and D produces fragments displaying in vitro ADP-ribosylating and apoptotic effects doc
Ngày tải lên :
18/02/2014, 04:20
... through DNA fragmentation, mitochondrial release of cytochrome c, and activation of caspase-9 and caspase-3 By contrast, the receptor caspase-8-dependent pathway did not contribute to ETA-induced apoptosis ... of cytosolic cytochrome c ( 15 kDa) (C) Hepatic cytosolic fractions isolated from ETA-injected or DT-injected rats were incubated with fluorescent substrates speci c for caspase-9, caspase-3, and ... N-Acetyl-b -d- glucosaminidase was assayed with p-nitrophenyl N-acetyl-b -d- glucosaminide as substrate, according to Touster et al [41] Acid phosphatase was assayed as described by Trouet [42] Caspase-3,...
- 15
- 588
- 0
Tài liệu Báo cáo khoa học: Mechanisms of obesity and related pathologies: Androgen deficiency and endothelial dysfunction may be the link between obesity and erectile dysfunction pptx
Ngày tải lên :
18/02/2014, 06:20
... its comorbidites are associated with reduced plasma testosterone levels Metabolic alterations associated with obesity include increased insulin, glucose and C- peptide levels, as well as reduced ... decreased plasma TT levels and endothelial dysfunction Obesity is associated with decreased TT, BAT and FT levels, as well as elevated E2 levels Such a decrease in TT levels is not associated ... production Because androgen deficiency is linked to the development of IR and T2DM, and the latter contributes profoundly to endothelium dysfunction and ED [130,131], the concept of androgen deficiency...
- 13
- 662
- 0
Tài liệu Báo cáo khoa học: Structural and functional specificities of PDGF-C and PDGF-D, the novel members of the platelet-derived growth factors family docx
Ngày tải lên :
19/02/2014, 07:20
... the PDGF -C growth factor domain indicates the disulfide bridges in PDGF -C to consist of Cys250 and 294, Cys280 and 335, and Cys287 and 337, and the intermonomeric bonds to consist of Cys274 and 286 ... fibrosis was induced by bleomycin, no change in the mRNA expressions of the classical PDGF -C and -D, structure and function PDGFs were detected, while PDGF -C and -D mRNA levels changed dramatically ... family PDGF -d and PDGF -D are now the accepted names for this gene and protein, respectively 5724 The pdgf genes PDGF -c and PDGF -d were named and placed in the PDGF ⁄ VEGF family because they encode...
- 19
- 557
- 0
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt
Ngày tải lên :
07/03/2014, 17:20
... models was checked by procheck [33] and whatif [61] The coordinates and structural factors have been deposited in the Protein Data Bank under the accession codes 2bgv, wt, 2bh5, M100K(rt) and ... M100K(cc) Unfolding monitored by UV/Vis spectroscopy and peroxidase activity GdmHCl (Aldrich 99%) was dissolved to m in water (Milli-Q) and filtered before use Solutions ranging from to m GdmHCl ... M & Randaccio L (2002) Cleavage of the iron-methionine bond in c- type cytochromes: Crystal structure of oxidized and reduced cytochrome c2 from Rhodopseudomonas palustris and its ammonia complex...
- 15
- 509
- 0
Báo cáo Y học: Variations in receptor site-3 on rat brain and insect sodium channels highlighted by binding of a funnel-web spider d-atracotoxin pdf
Ngày tải lên :
08/03/2014, 16:20
... voltage dependency and ability to differentiate between receptor site-3 of cockroach and locust sodium channels rather than between rat brain and cockroach pipettes d- ACTX-Hv1a was obtained from adult ... open symbols), and dissociation was induced after 60 of association by adding lM unlabelled d- ACTX-Hv1a (Fig 3B, open symbols) The calculated kon and koff under depolarized membrane conditions were ... pyrethroid insecticide known to modulate sodium channels, and like scorpion a-toxins [48] found that it had no allosteric effect on d- ACTX-Hv1a binding d- ACTX-Hv1a differentiates between cockroach and...
- 11
- 538
- 0
Autobiography and Letters of Orville Dewey, by Orville Dewey1Autobiography and Letters of Orville Dewey, by Orville DeweyThe Project Gutenberg EBook of Autobiography and Letters of Orville Dewey, D.D., by Orville Dewey This eBook is for the use of an pptx
Ngày tải lên :
16/03/2014, 02:20
... which I had not before considered, and that was the difference between words and ideas, between the terms we used and the actual conceptions we entertained, or between the abstract thesis and ... patient and mysterious search; and, indeed, no one could doubt that he was a most benevolent and kind-hearted man The occasion was this: He had been to our church one day, indeed, it was his last ... equal number of each Cole and Durand and Ingham and Inman and Chapman and Bryant and Verplanck and Charles Hoffman were in it when I first became acquainted with it; and younger artists have been...
- 141
- 503
- 0
chemical sensing and catalysis by one - dimensional metal - oxide nanostructures
Ngày tải lên :
19/03/2014, 16:47
... catalysis and gas sensing by semiconductors (52) The effect of an electrostatic field on the surface chemistry has also been reported for thin film semiconductors and FET-based chemical sensors fabricated ... or doped metal oxides configured as single crystals, thin and thick films, ceramics, and powders through a variety of detection and transduction principles, based on the semiconducting, ionic conducting, ... SENSORS, AND CATALYSTS 177 ACKNOWLEDGMENTS We thank Drs Y Zhang, G Cheng, and Y Lilach for their crucial contribution to this work and Profs H Metiu and E McFarland for helpful discussions and for...
- 30
- 414
- 0
Báo cáo khoa học: Expression of heme oxygenase-1 is repressed by interferon-c and induced by hypoxia in human retinal pigment epithelial cells pot
Ngày tải lên :
23/03/2014, 13:20
... for the HRE constructs and human Bach1 cDNA, respectively This work was supported in part by Grants-in-Aid for Scienti c Research (B), Scienti c Research (C) , for Exploratory Research, and for ... D4 07 cells In addition, hypoxia coordinately and rapidly induced expression of both HO-1 and Bach1 mRNAs in cultured rat and monkey cells, indicating that increased expression of Bach1 does not ... hypothesized that a certain degree of reduction in the HO-1 expression levels may be beneficial under pathological conditions, such as infectious diseases or cancers, because the reduced HO-1 expression...
- 9
- 420
- 0
Báo cáo khoa học: Identification and characterization of the metal ion-dependent L-alanoyl-D-glutamate peptidase encoded by bacteriophage T5 pdf
Ngày tải lên :
30/03/2014, 02:20
... muramidases, which hydrolyze the glycoside bond between N-acetylmuramic acid and N-acetylglucosamine; (b) lytic transglycosylases, which attack the same bonds as muramidases but additionally catalyze ... iondependent l-alanoyl -d- glutamate peptidase The enzyme is strongly inhibited by EDTA and BAPTA, and completely reactivated by Ca2+ and Mn2+ Considering BAPTA as a speci c chelator of Ca2+, we calculated ... Escherichia coli clones selected induced synthesis of a protein product of the expected size (about 15 kDa) The sequence of the lys gene in the plasmid was checked by sequencing both DNA strands...
- 14
- 413
- 0
the delivery of regenerative medicines and their impact on healthcare - c. prescott, d. polak (crc, 2011) ww
Ngày tải lên :
03/05/2014, 19:37
... add to Intellectual Capital Infrastructure and that can be patented, traded, sold, and amortized as a long-term capital asset Intellectual Capital Asset: the scientific and technical knowledge ... knowledge and discoveries upon which scientific and technological advances are based, including intellectual property that can be patented, traded, sold and amortized as a long-term capital asset ... Intellectual Capital Infrastructure: the overarching base of scientific and technical knowledge and discoveries upon which scientific and technological advances are based Intellectual Medical Research...
- 414
- 1.6K
- 0