c 0 01 for a parallel rlc circuit

... Instruction-Level Parallel (Fined-Grained Control Parallelism) • Process-Level Parallel (Coarse-Grained Control Parallelism) • Data Parallel (Data Parallelism) These categories are not exclusive ... library or set manually by the user, just like the case with OpenMP Beside basic loop parallelizing parallel _for constructs, TBB also have parallel patterns such as parallel_ reduce, parallel_ scan, ... than CUDA as it can support both task parallelism and data parallelism Data movements between the host and compute devices, as well as OpenCL tasks, are coordinated via command queues Command...

Ngày tải lên: 23/11/2012, 15:03

... Practical Guide for Studying Chuas Circuits 3.2.3 FPAA-based Chuas circuit model-III 3.2.4 FPAA-based Chuas circuit model-IV 68 69 Mixed-Mode Chaotic Circuit (MMCC): A Versatile Chaotic ... Original Chuas Circuit? 6.3.1 SC-CNN-based circuit 6.3.2 Continuous synchronization of SC-CNN-based circuits 6.3.3 Can an SC-CNN-based circuit behave synchronously with the original Chuas circuit? ... original chaotic behavior of Chuas circuit has also been captured with a smooth cubic nonlinearity [1 50] , piecewise-quadratic function 16 A Practical Guide for Studying Chuas Circuits [138] and...

Ngày tải lên: 12/12/2013, 08:29

... ideas Each new idea should be a new paragraph Typically, a TOEFL/TWE essay will have - body paragraphs C The conclusion: The conclusion will be your final paragraph It will summarize all the main ... Describe with Details (C) Compare (D) Explain with Reasons & Examples A company has announced that it wishes to build a large factory near your community Discuss the advantages and disadvantages of this ... because they have learned to count on each other Working as a member of a team will build strong character in students For more material and information, please visit Tai Lieu Du Hoc at www.tailieuduhoc.org...

Ngày tải lên: 23/01/2014, 06:20

... approximate solutions on the τ number N = h while the ratio h2 remains constant r N 16 24 30 40 50 60 h2 Residual 0. 5 0. 000 345 0. 000 08 0. 000 038 0. 000 014 0. 000 0 609 0. 000 0 309 Residual 0. 2 0. 000 064 ... 0. 000 064 0. 000 016 0. 000 007 0. 000 002 0. 000 001 0. 000 000 5 In what follows, we study the relation between the total (CPU) time spent on the performance of a program, the speedup and the efficiency ... Journal of Science, Mathematics - Physics 23 ( 200 7) 201 - 209 209 [4] J.R Galo, I Albarreal, M .C Calzada, J.L Cruz, E Fernandez-Cara, M Mari´n, Stability and Convergence of a Parallel ´ Fractional...

Ngày tải lên: 13/02/2014, 03:20

... Practical Guide for Studying Chuas Circuits 3.2.3 FPAA-based Chuas circuit model-III 3.2.4 FPAA-based Chuas circuit model-IV 68 69 Mixed-Mode Chaotic Circuit (MMCC): A Versatile Chaotic ... Original Chuas Circuit? 6.3.1 SC-CNN-based circuit 6.3.2 Continuous synchronization of SC-CNN-based circuits 6.3.3 Can an SC-CNN-based circuit behave synchronously with the original Chuas circuit? ... original chaotic behavior of Chuas circuit has also been captured with a smooth cubic nonlinearity [1 50] , piecewise-quadratic function 16 A Practical Guide for Studying Chuas Circuits [138] and...

Ngày tải lên: 18/02/2014, 22:20

... ⁄ 106 400 72 500 ⁄ 79 00 0 57 03 0 ⁄ 61 100 52 01 0 ⁄ 60 000 20 9 90 ⁄ 38 00 0 FEBS Journal 273 ( 200 6) 992– 100 3 ª 200 6 The Authors Journal compilation ª 200 6 FEBS 993 Regulation of DPP IV trafficking ... (1983) Characterization of a family of glycoproteins associated with the bile canalicular membrane of normal hepatocytes but not expressed by two transplantable rat hepatocellular carcinomas Cancer ... Horne WC & Baron R ( 200 3) Regulation of cytochrome c oxidase activity by c- Src in osteoclasts J Cell Biol 1 60, 709 –718 58 Champagne C, Landry MC, Gingras MC & Lavoie JN ( 200 4) Activation of adenovirus...

Ngày tải lên: 19/02/2014, 07:20

... ops/sec 900 0 700 0 600 0 500 0 400 0 300 0 200 0 100 0 800 0 600 0 400 0 200 0 0 Nodes ( 100 0 files per node) Application and GW Nodes (a) File metadata ops (b) Gateway metadata ops Figure 7: Metadata performance ... MB/sec 900 Aggregate Throughput MB/sec pNFS Write Performace 700 600 500 400 300 200 100 800 700 600 500 400 300 200 100 Clients Clients (a) pNFS Reads (b) pNFS Writes Figure 1: pNFS Read and ... 600 500 400 300 200 100 800 700 600 500 400 300 200 100 Clients (a) pNFS and NFSv4 Clients (b) Panache vs Standard GPFS Figure 6: Aggregate Write Throughput (a) pNFS and NFSv4 scale with available...

Ngày tải lên: 19/02/2014, 18:20

... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... the AAA superfamily typically contain one or two ATPase domains that assemble into one or two stacked hexameric rings The ATPase catalytic site is located at the interface between adjacent ATPase ... mix A B + Marginal ATPase activity Vps4p-RDF Vps4p-E233Q + Modest ATPase activity High ATPase activity β domain Catalytic site C- terminal helix Mutated catalytic site SRH Truncated C- terminal...

Ngày tải lên: 07/03/2014, 05:20

... the Americas Munteanu D S, A Fraser, and D Marcu D., 200 2 Improved Machine Translation Performance via Parallel Sentence Extraction from Comparable Corpora In Proceedings of the Human Language ... Pietra, and R L Mercer 1993 The Mathematics of Statistical Machine Translation: Parameter Estimation Computational Linguistics, V19(2) Callison-Burch, C and C Bannard 200 5 Paraphrasing with Bilingual ... transduction grammars and bilingual parsing of parallel corpora Computational Linguistics, 23(3) Yamada K and K Knight 200 1 A Syntax Based Statistical Translation Model In Proceedings of 39th Annual...

Ngày tải lên: 08/03/2014, 02:21

... antisense: 5¢-GGG GCT CGA GAA AAA AAA AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGG AAT TCG GGC CCG GGG-3¢) representing base pairs 18 30 1881 of the MARCKS cDNA [38] and cloning the resulting ... was constructed by annealing the two synthetic oligonucleotides (sense: 5¢-CCC CGG GCC CGA ATT CCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT TTT TTT TTC TCG AGC CCC-3¢; antisense: ... washed twice with · NaCl/Cit, 0. 2% SDS for 20 at 50 C, and then twice with 0. 2 · NaCl/Cit, 0. 2% SDS at 65 C for 20 prior to audioradiography with Kodak X-OMAT AR X-ray film Northern blot analysis...

Ngày tải lên: 08/03/2014, 08:20

... Ido Dagan and Kenneth W Church 1997 Termight: Coordinating humans and machines in bilingual terminology acquisition Machine Translation, 12:89- 107 Ido Dagan, Kenneth W Church, and William A Gale ... with an Italian and a German lexicon which contain 138,823 and 51 ,01 0 different word forms respectively To include the 15 ,01 3 (58,217) new Italian (German) word forms in our corpus the corresponding ... bilingual word alignment for machine aided translation In Proceedings of the Workshop on Very Large Corpora: Academic and Industrial Perspectives, pages 1-8 Nancy Ide, Greg Priest-Dorman, and Jean...

Ngày tải lên: 24/03/2014, 03:20

... shows a dotplot of a short article (25 kbytes) that appeared in a Christian Science magazine in both English and German, tokenized into 4-grams of characters The diagonals and squares are commonly ... used by translators to produce bilingual concordances for terminology research For this application, it is necessary that the alignment program accept noisy (realistic) input, e.g., raw OCR output, ... misplaced pages Charalign has succeeded in meeting many of these goals because it works at the character level and does not depend on finding sentence and/or paragraph boundaries which are surprisingly...

Ngày tải lên: 31/03/2014, 06:20

... 13 C 13 A B A A/ B b-Rha A B A A b-Rha A B A A b-Rha B A B A a-Rha B A B A a-Rha B A A a-Rha B A A A a-Rha B A A A a-Rha A A B a- Rha A A B a- Rha B A A A a-Rha B A B a- Rha Fuc3NAc B A A a-Rha Fuc3NAc ... B A A, B A A B A A A, B A A A, B A A A, B A A A, B A A A, B A A A, B A A A, B A A A Several of these combinations were found by means of an in-depth NMR analysis The a- Fuc3NAc influenced the chemical ... Fuc3NAc B A A a-Rha Fuc3NAc A A B a- Rha Fuc3NAc 4.814 97.8 4.818 97.8 4.764 97.3 4.7 70 97.3 5 .06 8 102 .8 5 .07 2 102 .8 5 .08 4 102 .8 5.119 102 .5 5.124 102 .5 5 .01 6 103 .0 5 .00 4 103 .0 5 .03 4 103 .0 5.261 101 .5...

Ngày tải lên: 31/03/2014, 09:20

... elliptic operators in unbounded cylinders, Adv Differential Equations (1999), no 6, 777–812 N C Apreutesei: Department of Mathematics, “Gh Asachi” Technical University of Iasi, 700 506 Iasi, Romania ... Fiz.-Mat 153 (19 90) , no 2, 79–81 (Russian) P W Bates, K Lu, and B Wang, Attractors for lattice dynamical systems, Internat J Bifur Chaos Appl Sci Engrg 11 ( 200 1), no 1, 143–153 S Goldberg, Introduction ... and A I Volpert, Properness and topological degree for general elliptic operators, Abstr Appl Anal 200 3 ( 200 3), no 3, 129–181 V A Volpert, A I Volpert, and J F Collet, Topological degree for...

Ngày tải lên: 23/06/2014, 00:20

Ngày tải lên: 05/08/2014, 09:46

... FPGAs Andrei Hagiescu, WengFai Wong, David F Bacon and Rodric Rabbah Design Automation Conference (DAC), 200 9 • Co-synthesis of FPGA-Based Application-Speci c Floating Point SIMD Accelerators Andrei ... private areas in the long-latency global memory, and performance is again significantly a ected The long stalls a ecting a warp that accesses global and local memory can be partially hidden if the scheduler ... of reconfigurable gates that can be reprogrammed to accelerate application-speci c code A broad class of applications, including multimedia, networking, graphics, and security codes, provide ample...

Ngày tải lên: 10/09/2015, 08:41

... personal copy J Appl Math Comput DOI 10. 100 7/s121 90- 014 -08 01- 6 ORIGINAL RESEARCH Parallel and sequential hybrid methods for a finite family of asymptotically quasi φ-nonexpansive mappings Pham Ky Anh ... Anh · Dang Van Hieu Received: 18 March 201 4 © Korean Society for Computational and Applied Mathematics 201 4 Abstract In this paper we study some novel parallel and sequential hybrid methods for ... of this article (doi: 10. 100 7/s121 90- 014 -08 01- 6) contains supplementary material, which is available to authorized users P K Anh (B) · D Van Hieu Department of Mathematics, Vietnam National University,...

Ngày tải lên: 14/10/2015, 08:19

... performance 0. 07 Etwinread 0. 06 PVFS Mread Time(s) 0. 05 SeqReadM 0. 04 PVFS Eread 0. 03 Eread 0. 02 Mread 0. 01 Mtwinread 10KB 20KB 50KB 100 KB 200 KB 500 KB Data file size Figure 4-7 Small File Performance ... potential bottlenecks; data are copied twice 20 with the client; when the applications access the file in small pieces, sequential access patterns can be a disadvantage [27] The Parallel Virtual ... database applications where availability and transaction rate are more important than storage efficiency [11] Figure 2-2 RAID-1 2.2.3 RAID-2 RAID-2 uses Hamming codes containing parity information...

Ngày tải lên: 28/11/2015, 13:26

Ngày tải lên: 08/08/2012, 17:20

... par1, int par2, double& par3);  par1 and par3 are call-by-reference formal parameters   Changes in par1 and par3 change the argument variable par2 is a call-by-value formal parameter  Changes ... change the value of a variable the corresponding formal parameter must be a call-by-reference parameter with an ampersand (&) attached Forgetting the ampersand (&) creates a call-by-value parameter ... both call-by-value and call-by-reference parameters Copyright © 200 7 Pearson Education, Inc Publishing as Pearson Addison-Wesley Slide 5- 22 5.3 Using Procedural Abstraction Copyright © 200 7 Pearson...

Ngày tải lên: 12/09/2012, 22:49