button of the path settings and browse to the c renesasdevcon2012micriumbitmap directory and select the small renesas logo image called logo renesas 200px jpg set the value property for this image to 0 you should see the following screen
Báo cáo khoa học: Mimicking phosphorylation of the small heat-shock protein aB-crystallin recruits the F-box protein FBX4 to nuclear SC35 speckles docx
Ngày tải lên :
23/03/2014, 13:20
... needle and the nuclei, free of cytoplasmic capping as judged by light microscopy, were pelleted by centrifugation for at 200 g to separate them from the cytoplasmic fraction The cytoplasmic fraction ... with a protease inhibitor cocktail from Roche) and incubated on ice for 20 NP- 40 was then added to a final concentration of 1% and incubation on ice continued for another 10 The cell suspension was ... Glembotski, C. C ( 200 3) Mimicking phosphorylation of aB-crystallin on serine-59 is necessary and sufficient to provide maximal protection of cardiac myocytes from apoptosis Circ Res 92, 203 –211 22 Conconi,...
- 9
- 381
- 0
state of the art in color image processing and analysis
Ngày tải lên :
24/04/2014, 13:36
... define the color space according to the most characteristic color components of a set of images application-dependent => e.g YST color space for human faces: Y – luminance; S – color average value ... Def.2: A color space SC is called mathematically complete iff includes all the colors possible to appear in the visible spectrum • P2 Compactness: Def.: A color space SC is called compact if any ... Cluster similar colors together (color points = vectors => the name “vector quantization” = VQ); determine the cluster centers; replace each image color with the closest cluster center G VQ codebook...
- 50
- 1.3K
- 1
Báo cáo khoa học: "Effects of mosapride on motility of the small intestine and caecum in normal horses after jejunocaecostomy" potx
Ngày tải lên :
07/08/2014, 23:22
... 100 .0 ± 0. 0% for the small intestine and 45.7 ± 19.3% vs 100 .0 ± 0. 0% for the caecum, Figs 2A and B) The EIG maximum amplitudes of the small intestine and caecum tended to increase from postoperative ... The ileum and jejunum were resected approximately 50 and 200 cm proximal to the ileocaecal junction, respectively After the surgical intervention, 20 mg/kg of cefalotin sodium and 1.1 mg/kg of ... ＜ 0. 05) compared with each preoperative value of the treated group (A) and the control group (B) *,†Significant differences (p ＜ 0. 05, p ＜ 0. 01) compared between the treated group and the control...
- 4
- 317
- 0
báo cáo khoa học: "Synchronous perforation of non-Hodgkin’s lymphoma of the small intestine and colon: a case report" ppsx
Ngày tải lên :
11/08/2014, 00:22
... prognosis The lack of specific complaints and the rarity of intestinal obstruction probably account for the delays in diagnosis Early diagnosis and systemic chemotherapy may prevent the occurrence of ... transverse colostomy was performed The resected segment of colon had the same clinical and pathological features of the jejunum After the Figure Transmural necrotic tract through the intestinal wall and ... malignances arise from the small bowel [8] They are more common in the ileum, consistent with the higher number of lymphocytes there [9] The frequency varies according to the geographic location and...
- 5
- 305
- 0
Báo cáo y học: "Intussusception of the small bowel secondary to malignant metastases in two 80-year-old people: a case series" potx
Ngày tải lên :
11/08/2014, 00:23
... lobular carcinoma and located in the colon and in the rectum [ 10- 13] In our first patient, the cause was metastatic invasive lobular carcinoma of the breast in the ileum, a condition which, to the best ... possible cause of intussusception Consent Written informed consent was obtained from both patients for publication of this case report and any accompanying images Copies of the written consent ... available for review by the Editor-in-Chief of this journal Page of References Blanco FC, Chahine AA: Intussusception [http://emedicine.medscape.com/ article/9 307 08-overview] Hurlstone DP, Donnely...
- 4
- 275
- 0
Báo cáo y học: "Characterization and comparative profiling of the small RNA transcriptomes in two phases of locust" docx
Ngày tải lên :
14/08/2014, 21:20
... mir-276 1 200 0 800 600 400 200 Volume 10, Issue 1, Article R6 candidate-3 700 00 6 500 0 600 00 5 500 0 500 00 4 500 0 400 00 3 500 0 300 00 2 500 0 200 00 1 500 0 100 00 500 0 candidate-7 candidate-9 candidate-18 ... GCGCGGCGUGCUACAUAGGUAUAAUUCGUCUCGGUGCACAUAGCCGCUUGCGUAUGAGCUCUUCCCGCGCGAGCUCUGCUUCACUUUUCUGUAGGGCCAGUUCAUGCUUUUUCAACUGCAA GCGCGGCGUGCUACAUAGGUAUAAUUCGUCUCGGUGCACAUAGCCGCUUGCGUAUGAGCUCUUCCCGCGCGAGCUCUGCUUCACUUUUCUGUAGGGCCAGUUCAUGCUUUUUCAACUGCAA ... GCGCGGCGUGCUACAUAGGUAUAAUUCGUCUCGGUGCACAUAGCCGCUUGCGUAUGAGCUCUUCCCGCGCGAGCUCUGCUUCACUUUUCUGUAGGGCCAGUUCAUGCUUUUUCAACUGCAA GCGCGGCGUGCUACAUAGGUAUAAUUCGUCUCGGUGCACAUAGCCGCUUGCGUAUGAGCUCUUCCCGCGCGAGCUCUGCUUCACUUUUCUGUAGGGCCAGUUCAUGCUUUUUCAACUGCAA GCGCGGCGUGCUACAUAGGUAUAAUUCGUCUCGGUGCACAUAGCCGCUUGCGUAUGAGCUCUUCCCGCGCGAGCUCUGCUUCACUUUUCUGUAGGGCCAGUUCAUGCUUUUUCAACUGCAA...
- 18
- 364
- 0
BIG TROUBLE FOR THE BIG THREE: AN AUDIENCE PERSPECTIVE OF THE APPROPRIATENESS AND EFFECTIVENESS OF THE BIG THREE AUTOMAKERS’ IMAGE REPAIR STRATEGIES
Ngày tải lên :
24/08/2014, 10:40
... apologia to the “accuser and others aware of the accusation” or the accused can only address those who are aware of the accusations and largely ignore the accuser A second audience can be the rhetor, ... required to employ tactics of crisis communication in order to repair their image are the Big Three Automakers They have been forced to respond to their recent economic debacles and acceptance of government ... in accordance with values (Benoit, 1995, p 78) Another tactic used to reduce the offensiveness of an act is to attack the accuser This, in turn, can damage the credibility and therefore the argument...
- 150
- 166
- 0
Documentation of the Small and Medium Scale Enterprise (SME) Survey in Vietnam for the Year 2002
Ngày tải lên :
02/04/2015, 15:27
... 0. 17 0. 15 Inputs to Costs 0. 75 0. 79 0. 79 0. 81 0. 75 0. 78 0. 83 0. 90 0. 80 0.83 0. 85 0. 87 0. 79 0. 80 0.79 0. 82 Wages to Costs 0. 18 0. 15 0. 16 0. 15 0. 20 0.16 0. 17 0. 09 0. 15 0. 13 0. 14 0. 10 0.19 0. 18 0. 17 ... 0. 14 Taxes to Costs 0. 07 0. 06 0. 04 0. 03 0. 05 0. 04 0. 01 0. 00 0 .05 0. 03 0. 01 0. 00 0 .02 0. 01 0. 04 0. 02 Total Assets (mill VND) 2594 793 1511 494 5461 13 10 431 178 1265 162 377 87 185 92 1 902 3 30 ... 26 Costs to Revenue 0. 89 0. 91 0. 85 0. 87 0. 87 0. 89 0. 78 0. 83 0. 77 0. 81 0. 78 0. 79 0. 83 0. 85 0. 83 0. 85 Profits to Revenue 0. 11 0. 09 0. 15 0. 13 0. 13 0. 11 0. 22 0. 17 0. 23 0. 19 0. 22 0. 21 0. 17 0. 15 0. 17...
- 26
- 317
- 0
Nanoscience the science of the small in physics engineering chemistry biology and medicine
Ngày tải lên :
14/03/2018, 15:26
... focusing to carbon nanostructures and Chap to bulk nanocrystalline materials In the Chaps and the topics of nanomechanics, nanophotonics, nanofluidics, and nanomagnetism are raised before in Chap ... Sciences (AAAS), American Association of Cancer Research, American Association of Physics Teachers, American Cancer Society, American Chemical Society, American Dental Association, American Institute ... products, and sunscreen (see Sect 11.11) Nanofilled resins are used to manufacture large-scale composite panels for production cars (see Sect 6.9) Other products include a scratch-resistant topcoat...
- 790
- 1.2K
- 0
Tài liệu An Assessment of the Small Business Innovation Research Program Project Methodology docx
Ngày tải lên :
17/02/2014, 06:20
... in scientific and engineering research, dedicated to the furtherance of science and technology and to their use for the general welfare Upon the authority of the charter granted to it by the Congress ... December 200 1 (See Annex B), and the funding necessary for the Academies to begin the study was received in September 200 2 The study was officially launched on October 200 2 The study will be conducted ... Ejector Arrays For Aerosol-Based Pulmonary Vaccine Delivery.” Response to SBIR Proposal PHS 200 1 NIP Topic 00 9, Technologies to Overcome the Drawbacks of Needles and Syringes Contract No: 200 - 200 1 -00 112...
- 125
- 421
- 0
Tài liệu Future Flight: A Review of the Small Aircraft Transportation System Concept pdf
Ngày tải lên :
17/02/2014, 06:20
... traf c control facilities, and safety services; and 16 Much of the data and description in this section are derived from the 200 0 Aviation Capacity Enhancement Plan (FAA 200 0a) 33 05 52 -03 Ch02 ... 737- 800 (1 60 passenger) and Airbus 3 20- 200 (1 50 passenger) require 6, 200 to 7, 600 feet of runway for takeoff, while an older Boeing 727- 200 (145 passenger) requires 10, 000 feet 25 05 52 -03 Ch02 ... research, dedicated to the furtherance of science and technology and to their use for the general welfare On the authority of the charter granted to it by the Congress in 1863, the Academy has a mandate...
- 135
- 2.4K
- 0
Tài liệu Báo cáo khoa học: Interaction of the small heat shock protein with molecular mass 25 kDa (hsp25) with actin doc
Ngày tải lên :
20/02/2014, 23:20
... used for estimation of nativity of actin preparations Corrected spectra of actin fluorescence excited at 297 nm were recorded in the range 300 – 400 nm on the Hitachi F- 300 0 fluorescence spectrophotometer ... equal to 0. 25 ± 0. 07; 0. 21 ± 0. 05, and 0. 15 ± 0. 06 lM in the absence of HSP25, and in the presence of the wild type HSP25 and its 3D mutant, respectively At the same time, both wild type and especially ... by the simultaneous addition of actin nuclei and salts Neither type of HSP25 had any significant effect on the critical concentration of actin (Fig 6A) Indeed the critical concentration of actin...
- 10
- 431
- 0
Báo cáo khoa học: "Prognostic factors in primary adenocarcinoma of the small intestine: 13-year single institution experience" ppt
Ngày tải lên :
09/08/2014, 07:21
... < 00 01), vascular invasion (p < 0. 000 1), and poor cellular differentiation (p < 0. 000 1) to be prognostic indicators, which is also analogous to the report of Brucher et al [14] Conclusion A complete ... Karnell LH, Menck HR, Scott-Conner C: The American College of Surgeons Commission on Cancer and the American Cancer Society Adenocarcinoma of the small bowel: review of the National Cancer Data Base, ... Hepatogastroenterology 200 3, 50( Suppl 2):ccxvi-ccxviii Sellerner F: Investigations on the significance of the adenoma – Carcinoma-Sequence in the Small Bowel Cancer 19 90, 66: 702 -715 Lashner BA: Risk factors for small...
- 6
- 325
- 0
Analysis the Statistical Parameters of the Wavelet Coefficients for Image Denoising
Ngày tải lên :
24/06/2015, 08:16
... Vol 29, No ( 201 3) 1-7 Tabel Comparision of PSNR of different wavelet thresholding selection for images corrupted by Gaussian noise Image Lena House Noise level 0. 001 0. 004 0. 001 0. 004 Universal ... noisy image and original image is calculated using imsubract command 9- Size of the matrix obtains in step is calculated 10- Each of the pixels in the matrix obtained in the steps is squared and calculate ... to the noisy coefficients 6-Meger low frequency coefficients with denoise high frequency coefficients in step 7- Invert the wavelet transform to reconstruct the denoised image 8- Difference of...
- 7
- 230
- 0
The role of the small GTPase rab31 in cancer
Ngày tải lên :
22/09/2015, 15:17
... activator of the nuclear factor-kappaB p65 transcription factor Cancer Res 200 9; 69: 701 3–21 Li Y, Ren J, Yu W, et al The epidermal growth factor receptor regulates interaction of the human DF3/MUC1 carcinoma ... and their regulators in exocytosis Biochem Soc Trans 200 6; 34: 683–6 Aloisi AL, Bucci C Rab GTPases-cargo direct interactions: fine modulators of intracellular trafficking Histol Histopathol 201 3; ... and MUC6) and their prognostic significance in human breast cancer Mod Pathol 200 5; 18: 1295– 304 Kufe DW MUC1 -C oncoprotein as a target in breast cancer: activation of signaling pathways and therapeutic...
- 10
- 352
- 0
Locked in tim false starts, negative feedbacks and the path to disarray of the thai party system
Ngày tải lên :
12/10/2015, 17:33
... 1974- 200 4 1968- 200 6 1992- 200 4 1947- 200 5 1947- 200 1 1946-1969 1951- 200 4 1993- 200 3 1999- 200 4 1988- 200 4 1955-1968 1992- 200 5 1992-1998 1979-1991 Number of elections 10 22 12 14 Average volatility 10. 7 ... electoral survival at each of the following critical junctures Accordingly, the main factor at the critical juncture was social cleavages, which were politically prominent in the population and ... arguments Counterfactual inferences are applicable to the analysis of causal contingencies and critical junctures By altering some features of the stories other than socio-political structures and comparing...
- 132
- 180
- 0
Cambridge.University.Press.Allegories.of.Union.in.Irish.and.English.Writing.1790-1870.Politics.History.and.the.Family.from.Edgeworth.to.Arnold.Oct.2000.pdf
Ngày tải lên :
21/09/2012, 10:39
... Postcolonial Theory and the Case of Castle Rackrent,’’ Criticism () Introduction In Seamus Heaney’s allegorical lyric, ‘‘Act of Union’’ (), the coupling of England and Ireland issues in the conception ... politically, and socially subordinate; in seeking to encourage conformity to one arm of the state, the established church, they undermine the power of another, the patriarchal family To reduce or ... England – and in the fictions about themselves that the English have told – has a speci c history that, once acknowledged, will complicate the received picture.¹⁵ We can see the effects of isolating...
- 240
- 1.2K
- 5
Báo cáo y học: "Use of the measure your medical outcome profile (MYMOP2) and W-BQ12 (Well-Being) outcomes measures to evaluate chiropractic treatment: an observational study"
Ngày tải lên :
25/10/2012, 10:06
... measuring clinical changes following chiropractic care on patients attending the RMIT University chiropractic teaching clinics The second objective was to investigate the validity of the MyMOP2 ... onto the follow-up form prior to this being given to the patient to score Therefore, the patient was aware of the symptoms they had previously nominated, but not the previous score Each of the ... sample of chiropractic patients with uncomplicated biomechanical neck or low back pain Chiropr J Aust 200 8, 38:75- 80 10 Bronfort G, Goldsmith CH, Nelson CF, Boline PD, Anderson AV: Trunk exercise combined...
- 8
- 538
- 0