but apis and websites have a lot in common

Tài liệu THE VICTORIAN TAXPAYER AND THE LAW A Study in Constitutional Confl ict doc

Tài liệu THE VICTORIAN TAXPAYER AND THE LAW A Study in Constitutional Confl ict doc

... direct taxation was limited to times of national emergency, generally war The principal direct tax was the land tax, originally a tax on real and personal property and incomes20 but it became a tax ... taxation, and the mechanics of assessment and collection, demanded and engendered a close and continuous relationship between the state and the taxpayer This made taxation a highly visible and ... cotton manufacturing industries all grew rapidly, and the development of the railways was astonishing, all stimulated by an expansion in markets and available labour resulting from a trebling of...

Ngày tải lên: 18/02/2014, 11:20

244 391 0
PROCEDURES ON IMPORTATION AND REGISTRATION OF A CAR IN SINGAPORE doc

PROCEDURES ON IMPORTATION AND REGISTRATION OF A CAR IN SINGAPORE doc

... standards as Singapore (at the time of its registration as a new car in Singapore) Fuel Economy Labelling Scheme (FELS) All cars and light goods vehicles are required to have CO2 (in g/km) and ... Open Market Value (OMV)] of the car by taking into account the purchase price, freight, insurance, handling and all other charges incidental to the sale and delivery of the car in Singapore Excise ... England Tianjin Automotive Test Centre A: Boxing Road, Beijing Economic and Technological Development Zone, Beijing, China B: Tianshanlukou, Chenglinzhuangdao, Tianjin, China 13 Annex B Page...

Ngày tải lên: 07/03/2014, 11:20

23 533 0
Báo cáo khoa học: PCSK9 is phosphorylated by a Golgi casein kinase-like kinase ex vivo and circulates as a phosphoprotein in humans doc

Báo cáo khoa học: PCSK9 is phosphorylated by a Golgi casein kinase-like kinase ex vivo and circulates as a phosphoprotein in humans doc

... Dewpura et al endogenous inhibitor, a catalytic domain characteristic of serine proteases and a C-terminal Cys- and His-rich domain implicated in enzyme stability and protein– protein interaction ... shots and masses were externally calibrated with All -in- 1 Protein Standards (Ciphergen Biosystems Inc.) All data were normalized for total ion current and peak areas calculated using the indirect ... the prodomain, the common naturally occurring A5 3V variation that has no significant effect on plasma cholesterol levels and the R46L variation, a naturally occurring variant associated with hypocholesterolemia...

Ngày tải lên: 16/03/2014, 06:20

14 454 0
Báo cáo sinh học: " HBx M130K and V131I (T-A) mutations in HBV genotype F during a follow-up study in chronic carriers" potx

Báo cáo sinh học: " HBx M130K and V131I (T-A) mutations in HBV genotype F during a follow-up study in chronic carriers" potx

... CAGGTTAAAGGTCTTTGTATTAGGAGGCTGTAGGCA 6604m_969CAGGTTAATGATCTTTGtatTAGGAGGctgTAGGCa 6516m_90-0 CAGGTTAAA TATTAGGAGGCTGTAGGCA 6541m_27-0 CAGGTtAAA TATTAGGAGGCTGTAGGCA 6290m_1232 CAGGTTAAA ... run in a 3% agarose gel Each pair of lines have the same sample treated with and without the Ssp I enzyme An HIV sample having the AATATT site was used as positive control in lanes and 2, sample ... lanes and (negative control), 1000 bp ladder marker lane 5, sample 6290 lanes and 7, sample 467 lanes and sample 6516 lines 10 and 11, sample 6541 lanes 12 and 13 The samples 467 and 6516 treated...

Ngày tải lên: 19/06/2014, 08:20

10 439 0
Báo cáo hóa học: "Urinary N-acetyl-beta -D-glucosaminidase and its isoenzymes A & B in workers exposed to cadmium at cadmium plating" pot

Báo cáo hóa học: "Urinary N-acetyl-beta -D-glucosaminidase and its isoenzymes A & B in workers exposed to cadmium at cadmium plating" pot

... creatinine) Urinary Total NAG (U/g of creatinnine) Urinary NAG -A (U/g of creatinnine) Urinary NAG-B (U/g of creatinnine) Urine cadmium Urinary Total NAG Urinary NAG -A Urinary NAG-B 1.000 0.738** ... of univariate analysis of variables that affect the urinary total-N-acetyl-beta -D-glucosaminidase and isoenzymes -A and B The levels of urinary total-N-acetyl-beta -D-glucosaminidase and its isoenzymes -A ... per minute in one liter of sample at 37°C The urinary Cd and urinary total N-acetyl-beta -D-glucosaminidase and its isoenzymes A & B were standardized with urinary creatinine concentration measured...

Ngày tải lên: 20/06/2014, 00:20

7 454 0
báo cáo hóa học:" HBx M130K and V131I (T-A) mutations in HBV genotype F during a follow-up study in chronic carriers" pdf

báo cáo hóa học:" HBx M130K and V131I (T-A) mutations in HBV genotype F during a follow-up study in chronic carriers" pdf

... CAGGTTAAAGGTCTTTGTATTAGGAGGCTGTAGGCA 6604m_969CAGGTTAATGATCTTTGtatTAGGAGGctgTAGGCa 6516m_90-0 CAGGTTAAA TATTAGGAGGCTGTAGGCA 6541m_27-0 CAGGTtAAA TATTAGGAGGCTGTAGGCA 6290m_1232 CAGGTTAAA ... run in a 3% agarose gel Each pair of lines have the same sample treated with and without the Ssp I enzyme An HIV sample having the AATATT site was used as positive control in lanes and 2, sample ... lanes and (negative control), 1000 bp ladder marker lane 5, sample 6290 lanes and 7, sample 467 lanes and sample 6516 lines 10 and 11, sample 6541 lanes 12 and 13 The samples 467 and 6516 treated...

Ngày tải lên: 20/06/2014, 04:20

10 359 0
báo cáo khoa học: " AtRabD2b and AtRabD2c have overlapping functions in pollen development and pollen tube growth" pptx

báo cáo khoa học: " AtRabD2b and AtRabD2c have overlapping functions in pollen development and pollen tube growth" pptx

... AtrabD2c-RP1 TCCCATTCTTGGAAACAAGTG AtRabD2b-F ATGAATCCTGAATATGACTAT Cloning AtRabD2b-R TCAAGAAGAACAACAGCCT AtRabD2c-F ATGAATCCTGAATATGACTAT Promoter::GFP/GUS fusion constructs were made for each ... the pENTR/ AtRabD2c-R TTAAGAGGAGCAGCAGCCT AtRabD2b-g-F caccATCGCTTATCCGCTCCGTGTATTTC AtRabD2b-g-R TAAAGACCCCTGGTCCTTCAGC AtRabD2c-g-F caccCTATCTCACTAAGCTGAAGATAC AtRabD2c-g-R GGCAATCTCTCCGGTTTGGTCC ... correct amplification product Table Primers used in this study LBb1 GCGTGGACCGCTTGCTGCAACT AtrabD2b-LP1 CCCTTCGTTGGGCTAGTAAAG AtrabD2b-RP1 TTCAACAACGTCAAACAATGG AtrabD2c-LP1 GCGCATTACTGAGAGAGAAGAG AtrabD2c-RP1...

Ngày tải lên: 11/08/2014, 11:21

16 209 0
Báo cáo khoa học: "Do statins have a role in preventing or treating sepsis" pptx

Báo cáo khoa học: "Do statins have a role in preventing or treating sepsis" pptx

... comorbidities and dissipated when the medication was discontinued There is growing interest among clinicians in the role that statins may play in preventing and treating serious infections If such an effect ... statins may also ameliorate sepsis-induced coagulopathy [5,8,9] Another novel pathway may play an important role in attenuating sepsis-induced endothelial dysfunction Heme oxygenase (HO)-1 is an ... smooth muscle and endothelial cells both in vitro and in vivo, suggesting that the anti-inflammatory, antiproliferative, and antioxidant effects of simvastatin occur largely through induction of...

Ngày tải lên: 12/08/2014, 23:21

3 260 0
Báo cáo khoa học: "The concentration of oxygen, lactate and glucose in the central veins, right heart, and pulmonary artery: a study in patients with pulmonary hypertension" ppt

Báo cáo khoa học: "The concentration of oxygen, lactate and glucose in the central veins, right heart, and pulmonary artery: a study in patients with pulmonary hypertension" ppt

... site as well as pulmonary artery occlusion pressure, mean arterial pressure, and cardiac index Table shows individual SO2 and [Lac] measured at each sampling site, and Figure shows graphs of mean ... right arm at intervals using an automated inflatable blood pressure measuring device Supplemental oxygen by mask was given to maintain arterial SO2, measured by pulse oximetry, above 98% at all ... Δ[Lac] The finding of greater SO2 and [Lac] in IVC and SVC than in pulmonary artery indicates that further dilution of oxygen and [Lac] takes place as blood flows through the right heart chambers...

Ngày tải lên: 13/08/2014, 03:20

7 415 0
Báo cáo y học: "hnRNP E1 and E2 have distinct roles in modulating HIV-1 gene expression" pps

Báo cáo y học: "hnRNP E1 and E2 have distinct roles in modulating HIV-1 gene expression" pps

... hnRNP E proteins have been implicated in a wide array of processes including mRNA stabilization, translational enhancement and translational silencing [32-34] Studies have also indicated a role for ... were separated and eluted with an organic gradient using a reverse phase C18 microcapillary column and analyzed in real time with a linear ion trap tandem mass spectrometer (LTQ, ThermoFinnigan) ... C-terminal KH domains were designated mycE1ΔN and mycE1ΔC, respectively A domain swap mutant was also generated consisting of the C-terminal KH domain of hnRNP E2 with the N-terminal KH domains and...

Ngày tải lên: 13/08/2014, 09:21

18 292 0
balasubramanian et al - 2010 - the relation between firm-level corporate governance and market value - a case in idian [icgi]

balasubramanian et al - 2010 - the relation between firm-level corporate governance and market value - a case in idian [icgi]

... corporate governance result in higher valuations in emerging markets? Another examination using a new data set Journal of Banking and Finance 33, 254–262 Patel, Sandeep A. , Balic, Amra, Bwakira, ... Balasubramanian, N., Black, Bernard, Khanna, Vikramaditya S., 2009 Firm Level Corporate Governance in India Working paper http://ssrn.com/abstract=992529 Bertrand, Marianne, Mehta, Paras, Mullainathan, ... exchanges maintains a website containing annual reports or financial statements for all listed firms Thus, firm websites are an important way that investors can obtain this information Table summarizes...

Ngày tải lên: 02/01/2015, 17:33

22 516 0
hedgehog and beaver have a picnic

hedgehog and beaver have a picnic

... should be addressed to School Permissions and Copyrights, Harcourt, Inc., 6277 Sea Harbor Drive, Orlando, Florida 32887-6777 Fax: 407-345-2418 HARCOURT and the Harcourt Logo are trademarks of Harcourt, ... for a picnic It is raining.” Bea ver looked out the window “I ve a plan,” Bea ver s aid “We can ve our picnic here,” s aid Bea ver “Oh, Bea ver,” s aid Hedgehog “That is a good plan!” Te a c ... Think Critically ea d- Where did Beaver tell Hedgehog they could go for the picnic at the beginning of the story? What did Beaver and Hedgehog decide to when it was raining? What did Beaver and...

Ngày tải lên: 13/01/2015, 14:12

10 219 0
The relationship between service quality, customer satisfaction, service quality and customer loyalty  a study in  telecommunication industry of laos

The relationship between service quality, customer satisfaction, service quality and customer loyalty a study in telecommunication industry of laos

... the findings of Parasuraman et al (1988), Reichheld and Sasser (1990), Farnell (1992), Cronin and Taylor (1992) and Anderson and Sullivan (1993) about the causal relations between service quality ... repetitive same-brand or same brand-set purchasing, despite situational influences and marketing efforts having the potential to cause switching behavior”, (p.34) The conceptualization and measurement ... techniques; data collection 6 Chapter 5: Analysis and result presents analysis procedures of collected data and the results Main analyses are descriptive analysis, exploratory factor analysis, reliability...

Ngày tải lên: 11/11/2015, 08:32

156 559 1
Natural botanical products have a long history in the world and are featured in using a complex

Natural botanical products have a long history in the world and are featured in using a complex

... hormone-refractory prostate carcinoma cells: mechanistic studies Int J Oncol 2002, 20:681-9 Yasukawa K, Ikeya Y, Mitsuhashi H, Iwasaki M, Aburada M, Nakagawa S, Takeuchi M, Takido M Gomisin A inhibits ... ultrasound-guided intratumoral injection of "Star-99" in treatment of hepatocellular carcinoma of nude mice World J Gastroenterol 2003, 9: 701-5 Nandakumar KS, Lakshmi Rao K, Pardhasaradhi BV, Khar A Upregulation ... prostate cancer cell growth and induce apoptosis by inhibiting androgen receptor expression [1] Besides, soybeans contain various anti-carcinogenic compounds including lunasin and lectins that...

Ngày tải lên: 03/11/2012, 09:54

9 713 0
The Carbon and Global Warming Potential Impacts of Organic Farming: Does It Have a Significant Role in an Energy Constrained World? pptx

The Carbon and Global Warming Potential Impacts of Organic Farming: Does It Have a Significant Role in an Energy Constrained World? pptx

... offers some additional, if smaller, potential for E and GHG gains (and again data for the Canadian food system is lacking) and a significant body of literature has examined relative E and GHG efficiency ... Peters et al [52] in Australia using an LCA analyses considered three scenarios; (1) a sheep meat supply chain in Western Australia, (2) a beef supply chain in Victoria, Australia producing organic ... including the growing of crops and livestock production, manufacture and application of agricultural inputs, processing, packaging, distribution and cold storage, preparing and serving, and disposing...

Ngày tải lên: 08/03/2014, 23:20

41 524 1
Báo cáo khoa học: H2O2, but not menadione, provokes a decrease in the ATP and an increase in the inosine levels in Saccharomyces cerevisiae An experimental and theoretical approach pot

Báo cáo khoa học: H2O2, but not menadione, provokes a decrease in the ATP and an increase in the inosine levels in Saccharomyces cerevisiae An experimental and theoretical approach pot

... 5Ânucleotidase), E3 (AMP deaminase), E4 (adenosine deaminase), E5 (purine nucleoside phosphorylase), E6 (adenylate kinase), E7 (adenosine kinase), E8 (a hypothetical enzyme catalyzing two general and ... degradation and the appearance of intermediate products were essentially the same in both cases and, above all, no appreciable differences in the rates of disappearance of ATP or appearance of Ino ... and incubated further for 120 At the times indicated, the adenylic charge, ATP and inosine were determined as described in Materials and methods H2O2 evokes a decrease and an increase in the intracellular...

Ngày tải lên: 17/03/2014, 10:20

12 506 0
Báo cáo Y học: Extra terminal residues have a profound effect on the folding and solubility of a Plasmodium falciparum sexual stage-specific protein over-expressed in Escherichia coli pptx

Báo cáo Y học: Extra terminal residues have a profound effect on the folding and solubility of a Plasmodium falciparum sexual stage-specific protein over-expressed in Escherichia coli pptx

... Pfg27C: 5¢-AAAAAGC TTATGAGTAAGGTACAAAAG-3¢ and 5¢-AAAAAGC TTTTAAATATTGTTGTGATGTGGTTCATC-3¢ (HindIII); Pfg27D: 5¢-AAAGAATTCATGAGTAAGGTACA AAAG-3¢ and 5¢-AAACTGCAGTTAAATATTGTTGT GATGTGGTTCATC-3¢ (EcoRI-PstI); ... Pfg27E:5¢-AAAC TGCAGATGAGTAAGGTACAAAAG-3¢ and 5¢-AAAA GCTTTCACTTCGAATTCCATGGTACCAG-3¢ (PstIHindIII); Pfg27F: 5¢-AAACTGCAGATGAGTAAGGTA CAAAAG-3¢ and 5¢-AAAAAGCTTTTACGACGTTGT GTGATGTGGTTCATC-3¢ (PstI-HindIII) ... CTGCAGATGAGTAAGGTACAAAAG-3¢ and 5¢-AAA AAGCTTAATATTGTTGTGATGTGGTTCATC-3¢ (PstIHindIII); Pfg27B: 5¢-AAACTGCAGATGAGTAAGGTA CAAAAG-3¢ and 5¢-AAACTGCAGTTAAATATTGTTG TGATGTGGTTCATC-3¢ (PstI); Pfg27C: 5¢-AAAAAGC...

Ngày tải lên: 23/03/2014, 21:20

5 436 0
w