bus collision during a stop condition case 1

Báo cáo khoa học: "Dramatic regression and bleeding of a duodenal GIST during preoperative imatinib therapy: case report and review" pot

Báo cáo khoa học: "Dramatic regression and bleeding of a duodenal GIST during preoperative imatinib therapy: case report and review" pot

... showed a partially necrotic mesenchymal mass with a diameter of cm, an infiltration of the duodenal wall leading to ulceration and perforation, an infiltration of the pancreas and two peripankreatic ... of a patients with a giant GIST of the duodenum After neoadjuvant imatinib therapy was initiated, a dramatic tumor regression led to an upper gastrointestinal bleeding and an emergency laparotomy ... tumor (GIPACT): gastrointestinal stromal tumors show phenotypic characteristics of the interstitial cells of Cajal Am J Pathol 19 98, 15 2 :12 59 -12 69 Miettinen M, Sarlomo-Rikala M, Lasota J: Gastrointestinal...

Ngày tải lên: 09/08/2014, 03:21

5 318 0
Báo cáo khoa hoc:" A patient with testicular pseudolymphoma – a rare condition mimicking malignancy: a case report" docx

Báo cáo khoa hoc:" A patient with testicular pseudolymphoma – a rare condition mimicking malignancy: a case report" docx

... Simultaneous evaluation of T- and B-cell clonality, t (11 ;14 ) and t (14 ;18 ), in a single reaction by a four-color multiplex polymerase chain reaction assay and automated high-resolution fragment analysis: ... including malignant lymphoma may be present Therefore, surgery was indicated in this case and a wait and see strategy would not have been justifiable However, our case demonstrates that in rare conditions ... Journal of Medical Case Reports 2007, 1: 71 http://www.jmedicalcasereports.com/content /1/ 1/ 71 indurated and cystic areas and involvement of the tunica vaginalis testis) the testis was removed...

Ngày tải lên: 11/08/2014, 10:22

3 111 0
Báo cáo y học: "Sudden deterioration due to intra-tumoral hemorrhage of ependymoma of the fourth ventricle in a child during a flight: a case report" pps

Báo cáo y học: "Sudden deterioration due to intra-tumoral hemorrhage of ependymoma of the fourth ventricle in a child during a flight: a case report" pps

... infants and young children Pediatrics 19 92, 90:385-3 91 10 Federal Aviation Administration: Allowable carbon dioxide concentration in transport category airplane cabins [http:// www.airweb.faa.gov/Regulatory_and_Guidance_Library/rgNPRM.nsf/ ... sinuses At a cabin pressure of 575 mmHg, gas expands to 13 2% of its baseline volume at sea level [10 ] Expansion of intestinal gas may have brought about a mild elevation of intra-abdominal pressure ... final manuscript Mahdavi et al Journal of Medical Case Reports 2 010 , 4 :14 3 http://www.jmedicalcasereports.com/content/4 /1/ 143 Author Details 1Department of Neurosurgery, Children's Hospital...

Ngày tải lên: 11/08/2014, 12:20

4 353 0
Báo cáo y học: " Hydrocarbon pneumonitis following liquid paraffin aspiration during a fire-eating performance: a case report" ppt

Báo cáo y học: " Hydrocarbon pneumonitis following liquid paraffin aspiration during a fire-eating performance: a case report" ppt

... Fire-eater's lung Eur Respir J 19 92, 5 :11 2 -11 4 Yokohori N, Taira M, Kameyama S, Kanemura T, Kondo M, Tamaoki J, Nagai A: Acute form of exogenous lipoid pneumonia caused by inhalation of liquid paraffin ... petrochemical industry We report a case of hydrocarbon pneumonitis in a 16 -yearold boy following liquid paraffin aspiration during a fireeating performance Case presentation A 16 -year-old boy was admitted ... Vimercati L, Lorusso A, Bruno S, Carrus A, Cappello S, Belfiore A, Portincasa P, Palasciano G, Assennato G: Acute pneumonia caused by aspiration of hydrocarbons in a fire-eater G Ital Med Lav Ergon...

Ngày tải lên: 11/08/2014, 21:22

4 176 0
Báo cáo y học: " Factitious lymphoedema as a psychiatric condition mimicking reflex sympathetic dystrophy: a case report" ppt

Báo cáo y học: " Factitious lymphoedema as a psychiatric condition mimicking reflex sympathetic dystrophy: a case report" ppt

... publication and carried out case preparation, DW was lead consultant and carried out case preparation Acknowledgements We would like to thank the imaging department of the Royal Victoria Hospital References ... Journal of Medical Case Reports 2008, 2: 216 http://www.jmedicalcasereports.com/content/2 /1/ 216 Figure Reduced distal radius fracture in plaster cast Reduced distal radius fracture in plaster cast ... extremity: analysis of total outcome of management of 12 5 cases Arch Phys Med Rehabil 19 81, 62 (11 ):B549-B554 Atkins R, Duckworth T, Kanis J: Features of algodystrophy after Colles fracture J Bone...

Ngày tải lên: 11/08/2014, 21:22

3 83 0
Báo cáo y học: " Non-syndromic multiple supernumerary teeth in a family unit with a normal karyotype: case report"

Báo cáo y học: " Non-syndromic multiple supernumerary teeth in a family unit with a normal karyotype: case report"

... a rare case Eur J Oral Sci 19 96 Apr ;10 4(2) :13 8-40 23 Garvey MT, Barry HJ, Blake M Supernumerary teeth – an overview of classification, diagnosis and management J Can Dent Assoc 19 99;65: 612 - 616 ... in the maxillary arch 10 , • agenesia 13 , 14 , 15 , • malposition of erupted permanent teeth 10 , 16 , • malocclusion 17 , 18 , 19 , • wide interincisive diastema 20, 21, • positive familial anamnesis ... present case also confirms that, in case of a set of symptoms coexisting with the clinical manife- 15 16 17 18 19 20 Capozzi L, Gombos F, Masi P, Modica R, Valletta G Patologia speciale odontostomatologica...

Ngày tải lên: 25/10/2012, 11:40

7 598 0
Tài liệu Appendix A: Library Database Case Study pdf

Tài liệu Appendix A: Library Database Case Study pdf

... PK,FK1 PK, FK1 NN FK,NN FK, NN FK,NN FK, NN 1 10 /13 / 91 10/27/ 91 10 /13 / 91 1 10 /27/ 91 07/07/ 91 07/ 21/ 91 07/07/ 91 2 2 07/ 21/ 91 10 /13 / 91 10/27/ 91 10 /13 / 91 2 10 /27/ 91 11/ 06/ 91 11/ 20/ 91 11/ 06/ 91 1 11 /20/ 91 ... 11 /20/ 91 1 10 /30/ 91 11/ 13/ 91 10/30/ 91 1 1 11/ 13/ 91 in_date fine_assessed fine_paid fine_waived in_date fine_assessed fine_paid fine_waived 10 /26/ 91 10/26/ 91 NULL NULL 10 /28/ 91 10/28/ 91 11/ 14/ 91 11/ 14/ 91 ... What percentage of all loans eventually becomes overdue? What is the average length of a loan? What are the library’s peak hours for loans? Appendix A: Library Database Case Study Library Database...

Ngày tải lên: 11/12/2013, 14:15

6 572 0
Tài liệu How To Use the Six Laws of Persuasion during a Negotiation pptx

Tài liệu How To Use the Six Laws of Persuasion during a Negotiation pptx

... you have to be able to “sell” your ideas in order to make changes in your favor and, in a win-win situation, provide the other side with a fair deal This entails a process that can appeal to ... in any negotiation, all parties should arrive at a conclusion that makes them feel like they got a good deal, especially if an on-going relationship is involved (Note: a “good deal” is not always ... favor And when you recognize that you are being manipulated, you can call the other side on their tactics and counter with an appropriate strategy This will lead to a more effective way of achieving...

Ngày tải lên: 21/12/2013, 04:18

6 501 0
Tài liệu How To Use the Six Laws of Persuasion during a Negotiation docx

Tài liệu How To Use the Six Laws of Persuasion during a Negotiation docx

... you have to be able to “sell” your ideas in order to make changes in your favor and, in a win-win situation, provide the other side with a fair deal This entails a process that can appeal to ... in any negotiation, all parties should arrive at a conclusion that makes them feel like they got a good deal, especially if an on-going relationship is involved (Note: a “good deal” is not always ... favor And when you recognize that you are being manipulated, you can call the other side on their tactics and counter with an appropriate strategy This will lead to a more effective way of achieving...

Ngày tải lên: 21/12/2013, 06:18

6 503 0
Tài liệu Module 7: Minimizing the Impact on Network Operations During a Domain Restructure docx

Tài liệu Module 7: Minimizing the Impact on Network Operations During a Domain Restructure docx

... the application or service in the domain Because these accounts are often defined both within the SAM database and within the application, special care must be taken when migrating service accounts ... registry and configuration changes Finding these changes may require searching through knowledge base articles and contacting the software manufacturer In worst -case scenarios, reconfiguration may ... If additional configuration is required for third-party applications that store configuration data in the user profile, ADMT is extensible and allows for additional code to be added to automate...

Ngày tải lên: 24/01/2014, 19:20

36 450 0
Tài liệu Báo cáo khoa học: "Japanese Dependency Parsing Using Co-occurrence Information and a Combination of Case Elements" pdf

Tài liệu Báo cáo khoa học: "Japanese Dependency Parsing Using Co-occurrence Information and a Combination of Case Elements" pdf

... method Sadao Kurohashi and Makoto Nagao 19 94 Kn parser: Japanese dependency /case structure analyzer In Proceedings of the Workshop on Sharable Natural Language Resources, pages 48–55 Sadao Kurohashi ... manner, we can analyze a sentence in a way similar to that used when analyzing the grammatical roles of words in inflected languages like German Japanese dependencies have the following characteristics: ... 719 –724 Sadao Kurohashi and Makoto Nagao 19 98b Japanese Morphological Analysis System JUMAN version 3.5 Department of Informatics, Kyoto University (in Japanese) References Eugene Charniak and Mark...

Ngày tải lên: 20/02/2014, 12:20

8 482 0
MARKETING DURING A DOWNTURN: INSIGHTS INTO HOW MARKETERS ARE HANDLING THE SLUMP pot

MARKETING DURING A DOWNTURN: INSIGHTS INTO HOW MARKETERS ARE HANDLING THE SLUMP pot

... revenues and ROIs of marketing programs, O’Connor says ” He’s talking about real data that shows, for example, not just how many clickthroughs you got on that banner ad campaign but how much actual ... paid search, natural search and email marketing Attendance to online and in-person events also remains strong Fewer than a third of respondents from small, medium and large companies are experiencing ... http://www.marketingsherpa.com/article.html?id=30388 Recession as Marketing Bonanza - a Contrarian (Yet Realistic) View: http://www.marketingsherpa.com/article.html?id=30344 PR in a Recession - CEO Fantasies & Case...

Ngày tải lên: 06/03/2014, 21:20

22 345 0
Báo cáo "LOCAL DIMENSION OF FRACTAL MEASURE ASSOCIATED WITH THE (0, 1, a) - PROBLEM: THE CASE a = 6 " pptx

Báo cáo "LOCAL DIMENSION OF FRACTAL MEASURE ASSOCIATED WITH THE (0, 1, a) - PROBLEM: THE CASE a = 6 " pptx

... log √ (14 ) # s2n +1 , √ n+2 (a1 − an+2 )3−2n | log a1 =1 2(n) log log (15 ) Combinating (14 ) and (15 ) we get α 1 Therefore log a1 log √ log (1 + 5) − log log a1 α =1 =1 log log The claim is ... √ k +1 (a1 − ak +1 )3−2k−2 | 2k log Since lim k→∞ | log √ k+2 (a1 − ak+2 )3−2k | | log = lim k→∞ 2(k + 1) log √ k +1 (a1 − ak +1 )3−2k−2 | log a1 =1 , 2k log log Local dimension of fractal measure ... (x1 − x1 ) + + 3(xn−2 − xn−2 ) + xn 1 − xn 1 = 2, which implies sn 1 − sn 1 ≡ (mod 3), hence xn 1 − xn 1 = (xn 1 = 6, xn 1 = 1) or xn 1 − xn 1 = 1 (xn 1 = 0, xn 1 = 1) are the cases 2 .a, ...

Ngày tải lên: 14/03/2014, 13:20

14 388 0
Guidelines for Use of Personal Protective Equipment by Law Enforcement Personnel During A Terrorist Chemical Agent Incident potx

Guidelines for Use of Personal Protective Equipment by Law Enforcement Personnel During A Terrorist Chemical Agent Incident potx

... CHEMICAL WARFARE AGENT VAPORS LIST OF ACRONYMS -v- A- 1 B -1 C -1 D -1 E -1 F -1 G -1 H -1 I -1 J -1 K -1 LIST OF TABLES Table Impermeable/Permeable Suit Comparison Table Considerations for Using Tactical ... 10 3 Hammer Coverall 15 2 Hammer 2-Piece 10 10 6 SWAT NBC Suit 18 6 TOMPS Suit 14 1 Saratoga® CPU 11 6 Lanx CPU 11 3 Table Overall PPDFs for SWAT Protective Suit Ensembles - 32 - A human factors evaluation ... Perimeter Concentration of Chemical Warfare Nerve Agent Vapors Table Table Table Table Table Table Table Table 10 Table 11 Table 12 Table 13 Table 14 Table 15 - vi - 14 20 27 32 C-3 C-4 C-5 C-5 C-6 C-6...

Ngày tải lên: 17/03/2014, 14:20

101 441 0
Learning to play games or playing games to learn? A health education case study with Soweto teenagers pptx

Learning to play games or playing games to learn? A health education case study with Soweto teenagers pptx

... knowledge related to viruses and bacteria, HIV/AIDS, cancer, malaria and tuberculosis Index 10 11 12 13 14 15 16 17 18 Concept Viruses reliance on host and ability to cause disease Bacterial independence, ... inheritability (concept 11 ) and the role of the environment in tuberculosis spread (concept 18 ) Amory 8 21 100 90 80 70 60 % 50 40 30 20 10 10 11 12 13 14 15 16 17 18 Concept Figure 5: Average scores ... indicated that they were able to identify the Object of the learning task For example I was learning about cancer and Hiv & Aids and I like the game because it teaches about aids, cancer and malaria...

Ngày tải lên: 22/03/2014, 15:21

20 453 0
Generic assessment procedures for determining protective actions during a reactor accident   IAEA

Generic assessment procedures for determining protective actions during a reactor accident IAEA

... 11 1 11 3 11 4 11 9 12 5 12 8 13 6 Table Ol Table Al Table A2 Table A3 Table A4 Table A5 Table A6 Table A7 Table A8 Table A9 Table Bl Table B2 Table B3 Table B4 Table B5 Table C1 Table Dl Table Fl Table ... P.O Box 10 0 A- 14 00 Vienna, Austria GENERIC ASSESSMENT PROCEDURES FOR DETERMINING PROTECTIVE ACTIONS DURING A REACTOR ACCIDENT IAEA, VIENNA, 19 97 IAEA-TECDOC-955 ISSN 10 11- 4289 ©IAEA, 19 97 Printed ... 13 Accident consequence assessment management 15 SECTION A: AO Al A2 A2 a A2 b A2 c A2 d A3 NUCLEAR CONDITION ASSESSMENT MANAGER PROCEDURES 19 Nuclear condition...

Ngày tải lên: 18/05/2014, 19:25

239 356 0
báo cáo sinh học:" Improving the implementation of health workforce policies through governance: a review of case studies" pdf

báo cáo sinh học:" Improving the implementation of health workforce policies through governance: a review of case studies" pdf

... revised staffing plan at that level, as shown in Costa Rica, Guatemala and South Africa [18 ,19 ,28] Typically, in such cases the administrative burden is also augmented, leaving less time and human resources ... district hospitals in South Africa: Translating principles into practice South African Medical Journal 2008, 98 (1) :46-49 Page 10 of 10 19 Garc a- Prado A, Chawla M: The impact of hospital management ... for actual care or treatment work [18 ] Studies from China and South Africa point out under-preparation of staff, managers and administrators at the decentralized level and claim that many health...

Ngày tải lên: 18/06/2014, 17:20

10 547 0
Báo cáo sinh học: "Community-acquired necrotizing pneumonia due to methicillin-sensitive Staphylococcus aureus secreting Panton-Valentine leukocidin: a review of case reports" pot

Báo cáo sinh học: "Community-acquired necrotizing pneumonia due to methicillin-sensitive Staphylococcus aureus secreting Panton-Valentine leukocidin: a review of case reports" pot

... estimated to cause 1 10 % of community acquired pneumonias (CAP) and 20–50% of nosocomial pneumonias [1] It is an important factor of influenza-related morbidity and mortality and approximately half ... pneumonia, who had a classical clinical presentation and was successfully treated with antitoxin antibiotics and intravenous immunoglobulin He was included in a review and analysis of clinical characteristics ... France Six publications originated in the United States, three in Asia, and one in Australia Cases occurred between 19 98 and 2009 Most case reports lack detailed data on history, clinical, and...

Ngày tải lên: 18/06/2014, 18:20

20 323 0
Báo cáo sinh học: " HBx M130K and V131I (T-A) mutations in HBV genotype F during a follow-up study in chronic carriers" potx

Báo cáo sinh học: " HBx M130K and V131I (T-A) mutations in HBV genotype F during a follow-up study in chronic carriers" potx

... CAGGTTAAAGGTCTTTGTATTAGGAGGCTGTAGGCA 6604m_969CAGGTTAATGATCTTTGtatTAGGAGGctgTAGGCa 6 516 m_90-0 CAGGTTAAA TATTAGGAGGCTGTAGGCA 6541m_27-0 CAGGTtAAA TATTAGGAGGCTGTAGGCA 6290m _12 32 CAGGTTAAA ... lanes and (negative control), 10 00 bp ladder marker lane 5, sample 6290 lanes and 7, sample 467 lanes and sample 6 516 lines 10 and 11 , sample 65 41 lanes 12 and 13 The samples 467 and 6 516 treated ... CAGGTTAAA TATTAGGAGGCTGTAGGCA 467h_969-0 CAGGttAAA TATTAGGAGGCTGTAGGCA Consensus CAGGTTAAATATTAGGAGGCTGTAGGCA SspI r e c o g n i t i o n s i t e stop codon responding to 17 63 17 70 nt of the...

Ngày tải lên: 19/06/2014, 08:20

10 439 0
Báo cáo hóa học: " Lower extremity fatigue increases complexity of postural control during a single-legged stance" potx

Báo cáo hóa học: " Lower extremity fatigue increases complexity of postural control during a single-legged stance" potx

... e 513 - 519 McGregor et al Journal of NeuroEngineering and Rehabilitation 2 011 , 8:43 http://www.jneuroengrehab.com/content/8 /1/ 43 10 11 12 13 14 15 16 17 18 19 20 Page 10 of 10 Cavanaugh JT, Guskiewicz ... 2 .1^ -27 PostRest vs PostFat 3.0^ -14 1. 1^- 21 8.3^-22 1. 4^232 7 .1^ 256 NA PreFat vs PostFat In all cases of significant values for Mean Differences, PostRest was greater than PreRest and Post Fat ... superficial to L3/L4, at the approximate center of mass [5] and secured with elastic tape (PowerFlex, Andover, MA) Triaxial signals from the HRA were streamed in real time to a base station at a frequency...

Ngày tải lên: 19/06/2014, 08:20

10 478 0
w