building qsar models a practical guide
Predicting Chemical Toxicity and Fate - Section 3 ppt
... more databases and prediction tools Database modules are available for mammalian metabolism, plant metabolism, photodegradation chemistry, and soil degradation chemistry For mammalian metabolism, ... Research on Cancer (IARC) Note: The Gene-Tox and GAP databases specifically focus on mutagenicity data; all the other databases contain both mutagenicity and carcinogenicity data For a detailed ... amines are chemicals with a great environmental and industrial importance, so a large database of experimental results has been generated (Woo and Lai, 2001) The availability of such a large quantity...
- 89
- 681
- 0
Báo cáo y học: " Derivation and preliminary validation of an administrative claims-based algorithm for the effectiveness of medications for rheumatoid arthritis"
... follow-up at one year, VARA and administrative data were used to create a gold standard and claims-based effectiveness algorithm The gold standard outcome was low disease activity (LDA, disease activity ... VARA participants to the national the Medical SAS files present in the administrative database from the Veterans Health Administration (VHA) from 2002-2010 to obtain medical and pharmacy claims ... evaluation of a large number of patients participating in an RA registry at 11 VHA medical centers All patients had rheumatologist-confirmed RA and wellcharacterized measures of RA disease activity...
- 29
- 581
- 0
Comparison of Methods for the Extraction of Bioflocculants from Activated Sludge
... extracellular polysaccharide from activated sludges Water Res., Vol.20, No.11, 1427-1432 Kobayashi, T., Takiguchi, Y., Yazawa, Y, Nakata, K., Ymaguchi, T and Kurane, R., (2002) Structural analysis ... in triplicates Estimation of flocculating activity Flocculating activity was estimated using a kaolin clay suspension The kaolin clay was treated with ethylenediaminetetra-acetate (EDTA) to prevent ... was small (relative A6 60 at was 0.796) In contrast, calcium and magnesium ions promoted activity (relative A6 60 values at were 0.442 and 0.490, respectively) to a greater degree than the trivalent...
- 11
- 695
- 1
Guide for the Selection of Chemical and Biological Decontamination Equipment for Emergency First Responders ppt
... chemical agent that can be taken up by inhalation or skin contact GF: A low volatility persistent chemical agent that is taken up through skin contact and inhalation of the substance either as a gas ... for activated charcoal, and as a filtering medium Fuller’s Earth may be used as a CB decontaminant if a better method for the decontamination/detoxification of chemical agents is unavailable ... decontaminant Microemulsions are thermodynamically stable mixtures of water, oil, surfactants, and co-surfactants that appear macroscopically as a homogeneous phase Different water-soluble decontaminants...
- 96
- 705
- 0
Guide for the Selection of Chemical and Biological Decontamination Equipment for Emergency First Responders pdf
... Aerospace Canada Ltd Irvin Aerospace Canada Ltd Irvin Aerospace Canada Ltd Irvin Aerospace Canada Ltd Los Alamos National Laboratory, NM D–3 Manufacturer Equipment Name ID # Page E-# MITI Manufacturing, ... Aerospace Canada Ltd Irvin Aerospace Canada Ltd 53 56 58 Irvin Aerospace Canada Ltd Irvin Aerospace Canada Ltd Alfred Karcher Gmbh & Company, Germany U.S Agent: Life Safety Systems Alfred Karcher ... operating the equipment 3.5.3 Training Available The Training Available data field refers to training provided by the manufacturer 3.5.4 Manuals Available The Manuals Available data field indicates...
- 186
- 600
- 0
nmr methods for the investigation of structure and transport
... book addresses both issues NMR methods and hardware explain the depth necessary to tackle engineering applications These applications are in a way more demanding than chemical analysis and medical ... monoexponential relaxation and a Gaussian line accounting for a statistical broadening Analysis with a pseudo Voigt function18 have been conducted on severely distorted spectra with a largely automated ... transverse magnetization is considered A basic experiment 20 Neglecting translational self diffusion and experimental artifacts Fourier transformation can be treated as special case of Laplace...
- 223
- 786
- 0
báo cáo hóa học: " The evolution of methods for the capture of human movement leading to markerless motion capture for biomechanical applications" pptx
... Arthritis and Rheumatism 1998, 41(7):1233-1240 Miyazaki T, Wada M, Kawahara H, Sato M, Baba H, Shimada S: Dynamic load at baseline can predict radiographic disease progression in medial compartment ... musculoskeletal biomechanics: visual hull and simulated annealing approach Annals of Biomedical Engineering conditionally accepted Mündermann L, Corazza S, Mündermann A, Lin T, Chaudhari AM, Andriacchi ... information and thus lack accuracy for accurate movement analysis However, biomechanical and, in particular, clinical applications typically require knowledge of detailed and accurate representation...
- 11
- 511
- 0
báo cáo hóa học:" Biomechanical testing of a polymer-based biomaterial for the restoration of spinal stability after nucleotomy" pptx
... significant at p < 0.05 ROM and NZ are Results Nucleotomy was performed by a standard microsurgical interlaminar approach Intradiscal implantation of the PGA-HA nucleus-implant as well as sealing ... However, analyzing all samples individually revealed a trend toward reduction of the NZ in every single sample with implantation of the PGA-HA nucleus-implant Statistical Analysis For statistical analysis, ... was approached from laterally, we performed a microsurgical dorsal approach, commonly utilized for lumbar disc herniations With this standard approach, lateral parts of the annulus and even lateral...
- 9
- 457
- 0
Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt
... ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 Type-specific PCR upper primer TGT GCT GCC ATA TCT ACT TCA GAA ACT AC Type-specific ... crystalline phase of superparamagnetic nanoparticles Table Hybridization probes and type-specific PCR primers Sequence Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT ... hybridization assay method only require extraction of DNA of the samples and simple incubation as well as magnetic separation, which has a good acceptability for any average lab assistant Table Comparison...
- 9
- 469
- 0
Cocoa Processing Methods for the Production of High Quality Cocoa in Vietnam ppt
... Placing of beans on a banana leaf layer 6: Heap fermentation Covering of beans with banana leaves 7: Covering of heap with Hessian bags to keep the heat in 8: Turning of beans by hand 9: Cocoa ... fermentation Therefore it is very important to cover cocoa beans during a fermentation Jute bags conserve heat better than banana leaves, so jute bags or a combination of banana leaves and jute bags ... of beans on a banana leaf layer Illustration 8: Covering of heap with Hessian bags to help keep the heat in Illustration 7: Heap fermentation Covering of beans with the banana leaves Illustration...
- 18
- 558
- 0
Standard Methods for the Examination of Water and Wastewater P4. end
... by American Public Health Association, American Water Works Association, Water Environment Federation Standard Methods for the Examination of Water and Wastewater before analyzing samples F– can ... by American Public Health Association, American Water Works Association, Water Environment Federation Standard Methods for the Examination of Water and Wastewater ions by ion chromatography Anal ... 1999 by American Public Health Association, American Water Works Association, Water Environment Federation Standard Methods for the Examination of Water and Wastewater b Generate accuracy and precision...
- 733
- 718
- 0
Standard Methods for the Examination of Water and Wastewater P3
... Amphiodia Amphipoda Anabaena Anacystis Anatanis Ancylidae Anisonema Ankistrodesmus Annelids Anodonta Anthophysa Anthopleura Antocha Aphanizomenon Aphanotheca Apple snail Arachnoidea Arcella Arthropods ... Acanthamoeba Achlya Achnanthes Acorus Acroneuria Actinastrum Actinomycetes Actinophrys Aedes Agardhiella Agnatha Alderflies Algae, brown Algae, green Algae, marine Algae, red Alona Alternaria ... Diatoms of the United States Exclusive of Alaska and Hawaii Vol 2, Fragilariaceae, Eunotiaceae, Acanthaceae, Naviculaceae Philadelphia Acad Natur Sci Monogr No 13, Philadelphia, Pa SOURNIA, A...
- 72
- 449
- 1
Standard Methods for the Examination of Water and Wastewater P2
... Water and Wastewater Anabaena © Copyright 1999 by American Public Health Association, American Water Works Association, Water Environment Federation Standard Methods for the Examination of Water and ... Water and Wastewater Anabaena © Copyright 1999 by American Public Health Association, American Water Works Association, Water Environment Federation Standard Methods for the Examination of Water ... and Wastewater Pandorina © Copyright 1999 by American Public Health Association, American Water Works Association, Water Environment Federation Standard Methods for the Examination of Water and...
- 163
- 721
- 3
Standard Methods for the Examination of Water and Wastewater P1
... symbols and abbreviations are used throughout this book: Abbreviation Referent AA A or amp AC ACS amu APHA ASTM AWWA atomic absorption ampere(s) alternating current American Chemical Society atomic ... by American Public Health Association, American Water Works Association, Water Environment Federation Standard Methods for the Examination of Water and Wastewater American Public Health Association ... Environment Federation Standard Methods for the Examination of Water and Wastewater Andrew D Eaton, AWWA Managing Editor Mary Ann H Franson Publication Office American Public Health Association 1015...
- 19
- 725
- 1
Báo cáo khoa học: "Comparison of Diagnostic Methods for the Detection of Parasites in Fish" pdf
... can help in this regard (Sirisinha 142 et al., 1991) DNA technology has had a major impact in many areas of parasitology, including the identification and classification of parasites, the diagnosis ... with parasites, while parasite prevalence of perch and roach samples ranged from 53.3 to 57.1% (Table 1) Table The results of fish parasitological examination by normal observation (for all parasites) ... Parasitology Classical and Molecular Techniques KVL, Copenhagen Bykhovskaya- Pavlovskaya, I.E., A. V Gusev, M.N Dubinina, N A Izyumova, T.S Smirnova, I L Sokolovskaya, G .A Shtein, S S Shul’man,...
- 9
- 559
- 0
Báo cáo khoa học: " Effective methods for the production of immunoglobulin Y using immunogens of Bordetella bronchiseptica , Pasteurella multocida and Actinobacillus pleuropneumoniae" docx
... and/or capsular polysaccharide contamination Results from analysis of laying rate and antibody titers indicate that immunization with only DNT was most effective in terms of survival and laying rates ... 1077-1081 11 Hatta, H., Tsuda, K., Ozeki, M., Kim, M., Yamamoto, T., Otake, S., Hirasawa, M., Katz, J., Chiders, N K and Michalek, S M Passive immunization against dental plaque formation in humans : ... titers against A pleuropneumoniae serotypes and were increased by combination with P multocida 3A (group 8) in sera (data not shown) Laying and survival rates The laying and survival rates of...
- 11
- 388
- 0
Báo cáo khoa học: " Comparison of two sap flow methods for the estimation of tree transpiration" ppt
... complete and is based on the energy balance of a part of the stem as described by Sakuratani [10], Valancogne and Nasr [12] and van Bavel and van Bavel [3] This method has been tested and validated ... sap and dT the temperature increase of the sap through the heater This apparatus can be made as described Sakuratani [10] or is commercially available by Dynamax Inc., Houston, Texas In our case, ... order to take into account the natural gradient The adjusted daily transpiration was % higher than direct measurement and evolves at the same pace as photosynthetically active radiation 2.1.2 Method...
- 7
- 326
- 0
Báo cáo sinh học: "Use of sib-pair linkage methods for the estimation of the genetic variance at a quantitative trait locus" pps
... that the method is robust against a variety of distributions of the trait examined and that it can also make use of multivariate data (Amos et al, 1989) G6tz and Ollivier (1992) found that in animal ... linkage a in the case of markers The approaches can be taken to estimate first approach arises in a situation where separate test linkage for markers lead to significant results If the marker ... realistic population structures and the inclusion of fixed effects, numerical approximations are needed to render practical data tractable by ML of § a significant or2can q a (1992) presented a...
- 14
- 299
- 0
Báo cáo y học: "An alternative methodology for the prediction of adherence to anti HIV treatment" ppt
... 40:288-293 Charalambous S, Innes C, Muirhead D, Kumaranayake L, Fielding K, Pemba L, Hamilton R, Grant A, Churchyard GJ: Evaluation of a workplace HIV treatment programme in South Africa AIDS 2007, ... http://www.euresist.org) Acknowledgements The authors would like to particularly thank Maurizio Zazzi [ARCA], Anders Sönnerborg [Karolinska], Rolf Kaiser [Arevir] for their data and Yardena Peres [IBM, Israel] for ... clinical data is a crucially important feature of treatment prediction models provided for practitioners to aid daily practice In addition, distinct characteristics of biological markers All authors...
- 6
- 447
- 0
báo cáo khoa học: " Social networks, work and network-based resources for the management of long-term conditions: a framework and study protocol for developing self-care support" potx
... status, use of self-care and self-care support, and a set of validated measures on aspects of social capital and social support A second survey instrument was administered and audio-recorded and ... results and implications from a national evaluation MJA 2008, 189:S21-S24 Abel T: Cultural capital and social inequality in health JECH 2008, 62:e13 Rogers A, Gately C, Kennedy A, Sanders C: Are ... illness-related work, relationships, and community belonging Whilst traditionally case and disease management remain the province of health professionals, a social-network approach means that the main...
- 7
- 331
- 0
- a practical guide to linux commands
- intellectual property and open source a practical guide to protecting code
- ship it! a practical guide
- a practical guide for independent
- a practical guide to solaris security
- a practical guide to protecting code
- fixing xss a practical guide for developers
- a practical guide to fedora and redhat enterprise linux fifth edition odd answers
- ship it a practical guide to successful software projects
- a practical guide to fedora and redhat enterprise linux odd answers
- a practical guide to fedora and redhat enterprise linux sixth edition answers
- a practical guide to fedora and redhat enterprise linux 6th edition answers
- a practical guide to fedora and redhat enterprise linux sixth edition odd answers
- a practical guide to fedora and redhat enterprise linux exercise answers
- a practical guide to fedora and redhat enterprise linux answers
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25