building and installing openssl on a unix system

Tài liệu Using Samba-2. Installing Samba on a Unix System-P1 pptx

Tài liệu Using Samba-2. Installing Samba on a Unix System-P1 pptx

Ngày tải lên : 21/01/2014, 07:20
... Binary or Source? Precompiled packages are also available for a large number of Unix platforms These packages contain binaries for each of the Samba executables as well as the standard Samba documentation ... downloading Samba For the best performance, choose a site that is closest to your own geographic location The standard Samba web sites have Samba documentation and tutorials, mailing list archives, ... Configure a makefile Compile the server code Install the server files Create a Samba configuration file Test the configuration file Start the Samba daemons Test the Samba daemons 2.1 Downloading...
  • 21
  • 289
  • 0
Tài liệu Using Samba-2. Installing Samba on a Unix System-P2 pdf

Tài liệu Using Samba-2. Installing Samba on a Unix System-P2 pdf

Ngày tải lên : 21/01/2014, 07:20
... correctly There are three ways to start: • By hand • As stand-alone daemons • From inetd 2.5.1 Starting the Daemons by Hand If you're in a hurry, you can start the Samba daemons by hand As root, simply ... /usr/local/samba swat stream tcp nowait.400 /usr/local/samba/bin/swat root swat And that's pretty much it for the installation Before you can start up Samba, however, you need to create a configuration ... commands: # /usr/local/samba/bin/smbd -D # /usr/local/samba/bin/nmbd -D At this point, Samba will be running on your system and will be ready to accept connections 2.5.2 Stand-alone Daemons To...
  • 21
  • 311
  • 0
Proposal for a COUNCIL DIRECTIVE on a common system of financial transaction tax and amending Directive 2008/7/EC pot

Proposal for a COUNCIL DIRECTIVE on a common system of financial transaction tax and amending Directive 2008/7/EC pot

Ngày tải lên : 29/03/2014, 18:20
... prevention of evasion, avoidance and abuse: delegated acts and administrative cooperation in tax matters The risk of relocation are tackled by the choice of an appropriate set of tax rates and a broad ... States shall apply the same rate to all financial transactions that fall under the same category pursuant to paragraph (a) and (b) Chapter III Payment of FTT, related obligations and prevention ... =1+ 1a +3 =2+ 2a Payments +3 TOTAL operational appropriations EN Commitments (4) N /A N /A N /A N /A N /A N /A N /A N /A Payments (5) N /A N /A N /A N /A N /A N /A N /A N /A Year N is the year in which implementation...
  • 31
  • 569
  • 0
Tài liệu DSXi™ Panels and Bays Connecting on a Whole New Level doc

Tài liệu DSXi™ Panels and Bays Connecting on a Whole New Level doc

Ngày tải lên : 21/12/2013, 07:15
... traditional DSX panels to improve density, manageability, and delivery Take a look at DSXi from ADC It’s connecting on a whole new level increased density Connect with DSXi panels and bays, and you ... sophisticated, DSX panels remain at the very heart of networks That’s why ADC, The Broadband Company™ and the industry’s leading supplier of DSX-1 equipment, continues to innovate and enhance traditional ... you can save valuable floor space By configuring a low-profile 84-circuit DSXi panel measuring only four inches high, you can increase your bay capacity from 11 standard panels to 14—for a total...
  • 6
  • 378
  • 0
Tài liệu Debugging C and C++ code in a Unix environment ppt

Tài liệu Debugging C and C++ code in a Unix environment ppt

Ngày tải lên : 21/01/2014, 06:20
... there are several formats for documentation in common use Manual pages Online manual pages (‘man-pages’) are the traditional format for documentation under Unix Man-pages are almost always reference ... assert macro, your program will be aborted as soon as an assertion fails, and you will get a message stating that the assertion expression failed at line l of file f assert is a macro; you can ... operating system functionality Unfortunately, there are a lot of small but significant differences among various Unix systems: • Some system calls are not available on all systems • Some system calls...
  • 29
  • 466
  • 1
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

Ngày tải lên : 18/02/2014, 14:20
... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG ... made up of a nine-stranded b-sheet flanked by a1 , a5 and g2 on one side and by a2 , a3 , a4 and g1 FEBS Journal 275 (2008) 5855–5864 ª 2008 The Authors Journal compilation ª 2008 FEBS A Pappachan ... towards pNPP at an acidic pH, around 5.5, and Tt SurE was maximally active at pH 8.2 St SurE shows almost no activity in the absence of divalent metal ions Activation by various metal ions was...
  • 10
  • 553
  • 0
The 1998 bleaching event and its aftermath on a coral reef in Belize doc

The 1998 bleaching event and its aftermath on a coral reef in Belize doc

Ngày tải lên : 07/03/2014, 17:20
... shelf lagoon, as well as on the outer barrier reef and in the lagoon at Glovers Reef, an atoll-like carbonate platform seaward of the barrier reef (McClanahan and Muthiga 1998; Aronson and Precht ... to obtain mean estimates of the abundance of juvenile corals and, separately, the abundance of E viridis for each depth at each station in each survey year Among-station means and standard errors ... personal communication; R.B .A and W.F.P., personal observation) As a result, E viridis has been the most abundant herbivore at Channel Cay and the other shoals for decades at least, and it consumed...
  • 13
  • 583
  • 0
Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

Ngày tải lên : 23/03/2014, 17:22
... Serological methods Rabbit antisera against Citrobacter strains PCM 1531 and PCM 1487 were prepared as described previously [21] Passive haemagglutination and inhibition of passive haemagglutination ... conclusion was confirmed and the a configuration of ara4dHex established using a NOESY experiment This showed H1,H3 and H1,H5 correlations for Rha at d 4.97/4.06 and 4.97/3.58, which are characteristic ... Fuc and 3-substituted Rha in the molar ratio  : These data suggest that the OPS-I and OPS-II have an identical branched tetrasaccharide repeating unit It consists of the main chain containing one...
  • 7
  • 478
  • 0
Optimization of design and operating parameters on the year round performance of a multi-stage evacuated solar desalination system using transient mathematical analysis

Optimization of design and operating parameters on the year round performance of a multi-stage evacuated solar desalination system using transient mathematical analysis

Ngày tải lên : 05/09/2013, 16:11
... the adjacent stages and also because of the absence of non-condensable gases heat transfer by radiation and natural convection are limited Thus, heat transfer between the hot saline water bed and ... performance are discussed in detail in this section 5.1 Variation of global solar radiation and ambient temperature The year round global solar radiation and ambient temperature data for Chennai ... solar desalination system The Multi-stage evacuated solar desalination system is a combination of evaporative-condenser unit and flat plate collectors The system is supplied heat additionally...
  • 26
  • 568
  • 0
a study of the emergence of management accounting system ethos and its influence on perceived system success

a study of the emergence of management accounting system ethos and its influence on perceived system success

Ngày tải lên : 08/04/2014, 12:07
... evidence that a variety of behavioural and organisational factors are intertwined with the implementation of activity based costing (ABC) systems and Anderson (1997) and Anderson and Young (1999) ... existence of relationships between contextual variables such as organisational commitment and shared organisational values and ABC implementation success Following an investigation of Canadian firms, ... is based on norms and values associated with a liation It emphasises flexibility and internal focus and stresses cohesion, morale and member participation in decision making as means and human...
  • 26
  • 544
  • 0
Báo cáo hóa học: " Mass spectrometry based on a coupled Cooperpair box and nanomechanical resonator system" pdf

Báo cáo hóa học: " Mass spectrometry based on a coupled Cooperpair box and nanomechanical resonator system" pdf

Ngày tải lên : 20/06/2014, 22:20
... polarization charge (in units of Cooper pairs), where Cb and Vb are, respectively, the capacitance and voltage between the NR and the CPB island, Cg and Vg are, respectively, the gate capacitance ... are also two sharp peaks located exactly at Δs = ±ωn in the sidebands of the absorption spectrum, which corresponds to the resonant absorption and amplification of the vibrational mode of the ... signal absorption spectrum Next, we illustrate how to measure the mass of the particles landing on the NR based on the above discussions Unlike traditional mass spectrometers, nanomechanical mass...
  • 8
  • 270
  • 0
Báo cáo hóa học: " European Union and German law on coexistence: Individualisation of a systemic problem" docx

Báo cáo hóa học: " European Union and German law on coexistence: Individualisation of a systemic problem" docx

Ngày tải lên : 21/06/2014, 01:20
... agreements between landowners of a region Landscape planning Taking Germany as a case landscape planning is aimed at (1) describing the present state and uses of natural areas and landscapes, (2) defining ... conventional, organic and GMO crop production, and if not, what can be done about it Results Measures of co-existence as laid down by German law (Sections 1 6a and 3 6a Act GenTG) and good practice ... objectives of nature protection and landscape preservation, (3) evaluate the factual situation and (4) elaborate measures in view of the defined objectives (Section (3) Federal Nature Protection Act (Bundesnaturschutzgesetz...
  • 6
  • 269
  • 0
Báo cáo hóa học: " Research Article Building Entry Loss and Delay Spread Measurements on a Simulated HAP-to-Indoor Link at S-Band" pdf

Báo cáo hóa học: " Research Article Building Entry Loss and Delay Spread Measurements on a Simulated HAP-to-Indoor Link at S-Band" pdf

Ngày tải lên : 21/06/2014, 23:20
... EURASIP Journal on Wireless Communications and Networking MEASUREMENTS AND DATA ANALYSIS The building penetration loss and the delay spread were measured as a function of elevation angle and building ... Transactions on Antennas and Propagation, vol 41, no 7, pp 954–961, 1993 [9] C Oestges and A J Paulraj, “Propagation into buildings for broad-band wireless access,” IEEE Transactions on Vehicular Technology, ... of concrete layer, thermal isolation, and roofing Gate area is separated by glass walls Windows are made of two-layer silver coated glass Aluminium lamellas are placed in front of the windows as...
  • 6
  • 269
  • 0
Báo cáo khoa học: "Effects of Protein Source and Energy Substrates on the In Vitro Development of Bovine Embryos in a Two-step Culture System" ppsx

Báo cáo khoa học: "Effects of Protein Source and Energy Substrates on the In Vitro Development of Bovine Embryos in a Two-step Culture System" ppsx

Ngày tải lên : 07/08/2014, 17:22
... formation According to Liu and Foote [14] nonessential amino acids (NEAA) have a stimulatory effect upon all developmental stages, and essential amino acids (EAA) enhance blastocyst formation and ... phosphate Citrate is an allosteric activator of acetyl-CoA carboxylase and thus plays a key role in the control of fatty acid synthesis, which stimulates blastocyst formation and the growth of rabbit ... Kwang-taek Lim, Byeong-chun Lee, Sung-keun Kang and Woo-suk Hwang Phosphate stimulates the activity of the glycolytic pathway, and as a result causes a decrease in ATP production via mitochondrial...
  • 6
  • 514
  • 0
Báo cáo y học: " Effects of cyclophosphamide on pulmonary function in patients with scleroderma and interstitial lung disease: a systematic review and meta-analysis of randomized controlled trials and observational prospective cohort studies" ppt

Báo cáo y học: " Effects of cyclophosphamide on pulmonary function in patients with scleroderma and interstitial lung disease: a systematic review and meta-analysis of randomized controlled trials and observational prospective cohort studies" ppt

Ngày tải lên : 09/08/2014, 13:22
... preparation CPW and ELM participated in the study design, data acquisition and analysis, and in manuscript preparation PJE participated in data acquisition and in manuscript preparation All authors ... Data presented as mean ± standard deviation AZA, azathioprine; CYC, cyclophosphamide; DLCO, diffusing capacity for carbon monoxide; FVC, forced vital capacity aPercentage predicted value at baseline ... read and approved the final manuscript Additional files The following Additional files are available online: Additional file Word table that reports the assessment of quality of randomized controlled...
  • 9
  • 477
  • 0
báo cáo khoa học: " Simultaneous measurement of sensor-protein dynamics and motility of a single cell by on-chip microcultivation system" pps

báo cáo khoa học: " Simultaneous measurement of sensor-protein dynamics and motility of a single cell by on-chip microcultivation system" pps

Ngày tải lên : 11/08/2014, 00:22
... and Tar-localization dynamics (red squares) with chemical stimulation Time course of tumbling frequency (blue circles) and Tar-localization dynamics (red squares) with chemical stimulation Hatched ... change Authors' contributions II carried out the microchamber design, cell preparation, single cell observation, image analysis and drafted the manuscript DS and IK prepared Tar-GFP vector and discussed ... novel assay for observing the protein-localization dynamics and the motility for generations was developed • The decreasing and recovery of the Tar-localization in a living bacterium was monitored...
  • 4
  • 166
  • 0
Báo cáo y học: "Ischemia as a possible effect of increased intraabdominal pressure on central nervous system cytokines, lactate and perfusion pressures" ppsx

Báo cáo y học: "Ischemia as a possible effect of increased intraabdominal pressure on central nervous system cytokines, lactate and perfusion pressures" ppsx

Ngày tải lên : 13/08/2014, 20:21
... ischemia mediators (IL-6, TNFa and lactate) Secondary end-points were the evaluation of the impact of IAH on ICP and ISP, cardiovascular, respiratory and acid-base homeostasis Statistical analysis ... auricular vein and general anaesthesia was induced by thiopental mg/kg, and fentanyl μg/kg, and the animal was intubated Basic monitoring (electrocardiogram, oxygen saturation, non-invasive pulse and ... cerebrospinal fluid; IL-6: interleukin 6, Lac: lactate, TNFa: tumor necrosis factor alpha Data are displayed as median and interquartile range in parentheses IL-6 and TNFa are expressed as pg/ml and lactate...
  • 10
  • 581
  • 0
global financial stability report; meeting new challenges to stability and building a safer system (imf, 2010)

global financial stability report; meeting new challenges to stability and building a safer system (imf, 2010)

Ngày tải lên : 01/11/2014, 19:18
... Sylwia Nowak, Jaume Puig, Christine Sampic, Manmohan Singh, Juan Solé, Tao Sun, Narayan Suryakumar, and Morgane de Tollenaere Martin Edmonds, Oksana Khadarina, Yoon Sook Kim, and Marta Sanchez Sache ... loans Asia = China, India, Indonesia, Malaysia, Korea; Latin America = Argentina, Brazil, Chile, Mexico; Europe and CIS = Hungary, Kazakhstan, Poland, Russia, Turkey, Ukraine; Middle East and Africa ... emerging markets.1 The estimation sample consists of annual data between 1994 and 2008 for Asian and Latin American economies, as well as South Africa and Turkey.2 The data reveal that emerging market...
  • 236
  • 502
  • 0
Developing the competitive strategy for thien hoa’s supermarket system on a retail market of the electronic and electrical appliances in Hochiminh city

Developing the competitive strategy for thien hoa’s supermarket system on a retail market of the electronic and electrical appliances in Hochiminh city

Ngày tải lên : 26/03/2015, 10:55
... production and operations, research and development, information processing to make organizations successful planned Strategic management is a continuous activity, Page GaMBA01.C0111 – Group Capstone ... pressures as Michael Porter‟s viewpoint to analyze 1.3.1.3 External factor evaluation matrix: External Factor Evaluation Matrix – EFE Matrix enables integrated management strategies and evaluate key ... institutions between countries International integration has become a major trend and important features of the current world dachi coordinate all international relations and major changes to...
  • 110
  • 572
  • 1
System on a chip  design and test

System on a chip design and test

Ngày tải lên : 08/03/2016, 11:38
... partitioning and task allocation Partitioning model Create simulation models, analyze and validate Scheduling model Communication model HW/SW interface definition Software specs Hardware specs Use case analysis ... GateEnsemble, Assura Vampire, Assura Dracula, Virtuoso and Craftsman from Cadence Design Systems; Hercules, Discovery, Planet-PL, Planet-RTL and Apollo from Avanti Corporation; Floorplan Manager, ... simultaneous analysis and optimization of area, performance, power, noise, test, technology constraints, interconnect, wire loading, electromigration, and packaging constraints Because SoC may also contain...
  • 292
  • 459
  • 0