bob has a surprise visitor

Ngày tải lên: 25/10/2013, 21:20

Ngày tải lên: 25/10/2013, 21:20

... containing a targeted replacement of the mouse apoE gene for the human apoE3 gene), we have shown that, in addition to its role in the maintenance of plasma lipid homeostasis, apoE plays a central ... had a much lower steady-state plasma FFA concentration of 1.4 ± 0.1 mmol eq.; P < 0.005) Despite this apparent increase in lipoprotein lipase-mediated FFA production and in steady-state plasma ... day, animals were gavaged with 0.3 mL of olive oil and placed back in their cages for h (in our experimental set-up, dietary triglyceride absorption, measured as a post-gavage increase in plasma...

Ngày tải lên: 05/03/2014, 23:20

... million-aire? HECTOR Psst, psst! Am I a millionaire? NICK [Laughs] Are you a millionaire? Are you a millionaire? [Laughs] Ha! We are millionaires! BRIDGET and ANNIE Good – good BRIDGET Well you can ... to wear? HECTOR But Nick, what about Bridget and Annie? NICK Aha! It’s not a problem! HECTOR [Laughs] Ah-ha-ha! Yes! ANNIE [sending email] ‘Nadia, it’s terrible news Hector killed my plant with ... Episode Hector Has a Date 11 HECTOR So, Nick, what should I say? NICK It’s easy, relax HECTOR Yeah, but you have had a hundred girlfriends NICK Yeah, well, when I said a hundred, it’s actually fewer...

Ngày tải lên: 15/03/2014, 17:20

... acid capsule is a virulence factor for mucoid group A streptococci Proc Natl Acad Sci USA 88, 8317–8321 49 Kawabata S, Kuwata H, Nakagawa I, Morimatsu S, Sano K & Hamada S (1999) Capsular hyaluronic ... deionized water (pH 9.0) containing 5% methanol as separation buffer A voltage of 20 kV was typically applied during CE separation, and +5 kV was used as electrospray voltage Mass spectra were acquired ... the HS:19 serostrain and have shown that these labile groups are an a- l-sorbofuranose branch attached at C2 of b-d-GlcA and a MeOPN modification located at C4 of b-d-GlcNAc There are very few reports...

Ngày tải lên: 16/03/2014, 13:20

... CTATGCTTTTGAA-3¢) and D18 8A- RV (5¢-TTCAAAAGC ATAGTATCCATAGCTGAGTAAATACCACCTCTTG-3¢), and the pPICZaA-ScOCH1 as a template The both D18 8A mutant and wild-type proteins were expressed as mentioned above After ... the contaminants may have a catalytic activity only toward the substrate (Man10GlcNAc2PA), where the first mannose was added to Man9GlcNAc2-PA, we purified Man10GlcNAc2-PA and used it as an acceptor, ... transmembrane region was amplified by PCR with two primers, OCH1-FW (5¢-CTCGAGAAAAGACACTTGTC AAACAAAAGGCTGCTT-3¢; the XhoI site is underlined) and OCH1-RV (5¢-TCTAGACGTTTATGACCTGCATTT Novel activity...

Ngày tải lên: 23/03/2014, 10:20

... variants with a molecular mass different to the most common variant An onco-fetal variant of BSSL, denoted feto-acinar pancreatic protein (FAPP), has been detected in human embryonic and fetal ... DNA was digested with appropriate restriction enzyme(s) Digested DNA was separated on an agarose gel, transferred to a Hybond-N ®lter (Amersham) and hybridized to a [32P]dATP-labelled probe as ... et al [32] Approximately 20 lg of each RNA preparation was separated on 1% agarose gels, blotted onto Hybond-N ®lters (Amersham International plc., Buckinghamshire, UK) and hybridized to a [32P]dATP-labelled...

Ngày tải lên: 24/03/2014, 03:21

... bỏ Thông thường ta dùng đại từ “who” thay cho danh từ đại từ người “he/ she/ they….” - Ta dùng “that” thay cho “who” trường hợp Ví dụ: The girl that looks like Taylor has a fair complexion - ... động từ chia “looks” Cấu trúc “look like” = “to be like” – giống như, - “The girl … .has a fair complexion” – cô gái ….có (một) da trắng a fair complexion” = a fair skin” – da đẹp, da trắng Cụm ... looks like Taylor has a fair complexion 2 Các bạn di chuột vào cụm từ để biết chức cụm câu: The girl who looks like Taylor has a fair complexion 3 Tại câu lại dịch vậy? - Mệnh đề quan hệ xác...

Ngày tải lên: 25/03/2014, 03:21

... official language of Jamaica, most Jamaicans actually speak a pidgin version of the language including words adopted from various African languages and a great deal of slang So, if Bob wanted ... born to a black Jamaican mother, Cedella Malcolm, and a white Jamaican father, Captain Norval Sinclair (or Saint Clair) Marley The two were an odd pair as Cedella was only 18 and Norval, a member ... of the album were released with a traditional package that displayed a large picture of Bob taking a hit off a large cone-shaped spliff (Jamaican slang for a marijuana cigarette) For this album,...

Ngày tải lên: 30/03/2014, 00:20

... GCGGCCAGCGTATCAATAGCC-3¢ (sense), 5¢-GGCT ATTGATACGCTGGCCGCGTCTCCTTCAACTCCCT CG-3¢ (antisense); K56 8A, 5¢-CCGGTTGGCGGCGTAAC CGCAGCGGTTGAGGCAGCTATAGAAGC-3¢ (sense), 5¢-GCTTCTATAGCTGCCTCAACCGCTGCGGTTAC ... protein as well as fused to a AAA+ ATPase-domain (Fig 1C) [6] Whereas the bacterial Lon protease and its homologues in eukaryal organelles are soluble, the archaeal counterpart is membrane-attached ... significant sequence similarity to Lon proteases [21] (Fig 1A, B) TaLon encompasses an N-terminal ATPase associated with various cellular activities (AAA+ domain) and a C-terminal protease domain,...

Ngày tải lên: 30/03/2014, 15:20

... H4 labeled A2 a, A2 b, A3 a, A3 b, A4 a and A4 b, respectively (Fig 4A) The 1D-NOESY of Gal H- 4a showed NOEs for Gal H- 2a, Gal H- 3a, Gal H-5 and Gal H-6 ⁄ 6¢, as well as for Fru H-4 and Fru H-6 ⁄ 6¢ ... respectively The 31 P chemical shift for the MeOPN groups was 14.67 p.p.m., and a scalar coupling 3JP,H of 11.1 Hz was observed CPS-2 Atom Type dH dC A1 A2 a A2 b A3 a A3 b A4 a A4 b A5 A6 ⁄ A6 ¢ B1 ⁄ B1¢ B2 B3 ... MeOH as mobile phase A voltage of 20 kV was 4419 Campylobacter jejuni HS:1 serostrain CPS typically applied during CE separation and )5 kV was used as electrospray voltage Mass spectra were acquired...

Ngày tải lên: 30/03/2014, 20:20

... For example, a professional pianist like Gary Graffman unquestionably has enlarged hand and finger maps His maps are larger than average because they are crammed full of finely honed neural wiring ... organization; the right parietal lobe is less specialized for spatial awareness This trait may be more pronounced in anorexia patients Added to this anatomical variation is the fact that early ... example), a freestanding cardboard partition, a table, two chairs, and a friend Sit down and lay the rubber arm facing away from yourself, palm down, on the table in front of you Lay your real hand palm...

Ngày tải lên: 29/06/2014, 09:20

... interpretation, manuscript drafting and final approval; KA participated in data analysis and interpretation, manuscript drafting and final approval CY participated in data acquisition and analysis, manuscript ... manuscript drafting and final approval; BL participated in data acquisition and analysis, manuscript drafting and final approval; GW participated in study design, data analysis and interpretation, manuscript ... looking at SLNB status and ulceration as individual variables, we incorporated those factors into the patients’ AJCC stage as a way to provide more accurate, clinically relevant survival information...

Ngày tải lên: 09/08/2014, 01:24

... was 5'-CAACTGCTCCAAGGATAGATGATGA-3'and the reverse primer was5'-CCAGCTTCCTCAACCACAATAAATG-3' The probes were labelled at their 5' ends with FAM™ (the C allele) and VIC™ (the T allele) and the ... 1858T variant and future development of RA This association is stronger than that for HLA-SE and is the better predictor for RA We also show an association between the T variant and anti-CCP antibodies ... L, Alonso A, Rahmouni S, Nika K, Rostamkhani M, MacMurray J, Meloni GF, Lucarelli P, Pellecchia M, et al.: A functional variant of lymphoid tyrosine phosphatase is associated with type I diabetes...

Ngày tải lên: 09/08/2014, 07:20

... The authors declare that they have no competing interests Authors' information JK participated in the study design and data retrieval and analysis KY, KK, ES participated in data retrieval and analysis ... chemoradiation in rectal adenocarcinoma Zhonghua Zhong Liu Za Zhi 2008, 30(8):602-605 Kikuchi M, Mikami T, Sato T, Tokuyama W, Araki K, Watanabe M, Saigenji K, Okayasu I: High Ki67, Bax, and thymidylate ... Rudisch A, Judmaier W, de Vries A: Dynamic T(1) mapping predicts outcome of chemoradiation therapy in primary rectal carcinoma: sequence implementation and data analysis J Magn Reson Imaging 2007,...

Ngày tải lên: 09/08/2014, 09:20

... GGCATCATTCATGTGACAC AS: GCATCGTAGGTCTGTCCTG 364 MMP-3 S: GAAAGTCTGGGAAGAGGTGACTCCAC AS: CAGTGTTGGCTGAGTGAAAGAGACCC 284 Osteocalcin S: CATGAGAGCCCTCACA AS: AGAGCGACACCCTAGAC 310 Alkaline phosphatase ... phosphatase S: TGCAGTACGAGCTGAACAG AS: TGAAGACGTGGGAATGGTC 267 Type I collagen α1 chain S: CCGAAGGTTCCCCTGGACGA AS: CGCCCTGTTCGCCTGTCTCA 252 18S S: GAATCAGGGTTCGATTCCG AS: CCAAGATCCAACTACGAGC 279 ... Montreal Hospital Centre Knee joint swelling calculation Animals were examined daily and knee diameter was measured using a digital calliper (model #2071M, Mitutoyo Corporation, Kawasaki, Japan) as...

Ngày tải lên: 09/08/2014, 10:20

... 5'-GACAGGTTCAGGTCATAGAAG-3' for At5g21920, 5'-TATCTGAACACTCCGTTGACGGTA-3' and 5'-CAAAGATA AACGGAATACGATC-3' for At4g27990, 5'-GCAATGGGAAGCAGTGGTGG-3' and 5'-GGGAGAAGAGACGGGTTTCG-3' for GAPDH, and ... (Takara) with oligo(dT)15 primer PCR was performed by using primers 5'-CACCGAGAAGTCAACAGCTCGGTCATCGAC-3' and 5'-TCAAGTCTTCCAATTTCTACCCAGTGCTGC-3' for AtYLMG1-1, 5'CCTCAACATATATAACACCATC-3' and ... inserted 35S-cDNA in the FOX lines, the insertion was amplified by PCR using primers 5'GTACGTATTTTTACAACAATTACCAACAAC-3' and 5'-GGATTCAATCTTAAGAAACTTTATTGCCAA-3', and then sequenced by a primer 5'-CCCCCCCCCCCCD...

Ngày tải lên: 12/08/2014, 03:21

... project planning, participated in the data analysis and helped to draft the manuscript All authors read and approved the final manuscript Weissman AM: Themes and variations on ubiquitylation Nat Rev ... Molecular cloning, characterization, and dynamics of rat formiminotransferase cyclodeaminase, a Golgi-associated 58-kDa protein J Biol Chem 1998, 273:33825-33834 Nakamura N, Rabouille C, Watson ... (clone Rab7-117; 1:50; SIGMA), and -CD63 (clone H5C6; 1:200; BD) antibodies AlexaFluor 488- or AlexaFluor 647- conjugated goat anti-rabbit, AlexaFluor 546- or AlexaFluor 647- conjugated goat anti-mouse,...

Ngày tải lên: 12/08/2014, 04:20

... cDNA microarray Plant J 2003, 34:868-887 Seki M, Narusaka M, Ishida J, Nanjo T, Fujita M, Oono Y, Kamiya A, Nakajima M, Enju A, Sakurai T, Satou M, Akiyama K, Taji T, Yamaguchi-Shinozaki K, Carninci ... function as transcriptional activators in abscisic acid signaling Plant Cell 2003, 15:63-78 Seki M, Ishida J, Narusaka M, Fujita M, Nanjo T, Umezawa T, Kamiya A, Nakajima M, Enju A, Sakurai T, Satou ... L-methionine was used Five double stranded oligonucleotide probes were made: DREB 5'tgactaCCGAcatgagttcc3', ABF 5'ccttgtccacGTGTatc atc3', DOF 5'atcttatatAAAGcaccatt3', and GBF 5'cttgtccAC GTGtatcatca3'...

Ngày tải lên: 12/08/2014, 05:20

... MI participated in the acquisition and interpretation of the data and drafted the manuscript AMO and I Castrejon participated in the data acquisition and helped to draft the manuscript AG-V and ... (Programa de Intensificación de la Labor Investigadora) Author details Rheumatology Department, Hospital Son Llàtzer, Carretera Manacor km 4, Palma de Mallorca, 07198, Spain 2Rheumatology Department, ... (mg/month) and the annual variation in BMD (mg/cm2/year) (a) ultradistal, (b) distal, and (c) mid-forearm Data are shown as dot plots and the estimated linear regression (dotted line) Ibañez et al Arthritis...

Ngày tải lên: 12/08/2014, 12:20