biota as a medium for chemical elements

Tài liệu Songs as a Medium for Embedded Reproductive Messages doc

Tài liệu Songs as a Medium for Embedded Reproductive Messages doc

... Chair/BNA Mercury Nashville MCA Nashville MCA Nashville Columbia Nashville Warner Bros Jason Aldean Dierks Bentley Alan Jackson Justin Moore Brad Paisley Rascal Flatts Keith Urban Brad Paisley Zac ... a content analysis of the lyrics contained in a sample of representative art songs and opera aria dating back as far as 1597 Arias are usually a melodic segment set within the context of a larger ... Band Brad Paisley Capitol Nashville/Broken Bow Dangling Rope/Capitol Records Nashville Arista Nashville/EMI Nashville Valory Music Group Arista Nashville Lyric Street Capitol Nashville Arista...

Ngày tải lên: 13/02/2014, 16:20

27 315 0
Food media food and technology as a medium for social communication

Food media food and technology as a medium for social communication

... Khoo, Hooman Samani, Nimesha Ranasinghe, Dilrukshi Abeyrathna, Weiquan Lu, Kening Zhu, Elham Saadatian, Kasun Karunanayaka, , Shuang Yu, Haimo Zhang, Zhongyuan Zhang, Toni-Jan Keith Monserrat, Chen ... verbal and nonverbal behavior of their avatars, such as the facial expression, gaze, and speech [9] By augmenting their representational, sensory, and situational characteristics, interactants may ... daily activities in an interactive way Basically, a communication process can occur on an instantaneous or a delayed basis, categorized into synchronous and asynchronous communication Communication...

Ngày tải lên: 10/09/2015, 09:02

263 303 0
Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly

Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly

... samples was created by a laboratory panel (n ¼ 9; females, males, aged 25 –41 years) trained to evaluate attributes selected in advance The attributes were evaluated on a 9-point scale that was ... Preliminary data analysis revealed no significant main effects and only one significant interaction of day and aroma on the pleasantness ratings of the young, implicating an increase in pleasantness ... Hedonic ratings In the pleasantness ratings, the aroma concentration had a similar effect on both age groups in the first tasting session: the heightened aroma sample was rated as less pleasant than...

Ngày tải lên: 03/04/2013, 21:06

10 599 1
Knowledge Management as a Catalyst for Innovation within Organizations: A Qualitative Study

Knowledge Management as a Catalyst for Innovation within Organizations: A Qualitative Study

... Our MD came across an innovation in hair care in Italy, the hair brush package was designed open so that you could feel the bristles before purchase Back at base nothing happened as our marketing ... essential part of the organization (Hedlund and Nonaka, 1993) McCartney (1998) states that `the activities that give rise to innovation are basically R McAdam Knowledge and Process Management RESEARCH ... cycles, innovation streams, and ambidextrous organisations: organisational renewal through innovation streams and strategic change In Managing Strategic Innovation and Change, Tushman ML, Anderson...

Ngày tải lên: 18/10/2013, 12:15

9 498 2
Module 7: Microsoft Proxy Server 2.0 as a Solution for Internet Connectivity

Module 7: Microsoft Proxy Server 2.0 as a Solution for Internet Connectivity

... Network Load Balancing provides a greater benefit than round robin DNS entries because Network Load Balancing automatically excludes servers that are unavailable You can enhance the availability for ... Server as LAN interfaces are persistent, and the data rate is determined by the LAN technology Public network segments that appear as demand-dial interfaces are nonpersistent, and the data rate ... servers make up a proxy array called proxyarray.msft Each of the servers in the array has a unique IP address, so you need to specify an A- type resource record for each server as follows: proxyarray.msft...

Ngày tải lên: 18/10/2013, 18:15

62 359 0
Module 8: Routing as a Solution for Private Network Connectivity

Module 8: Routing as a Solution for Private Network Connectivity

... of applications that can take advantage of multicast transmissions RIP -for- IP version is an example of a protocol that can take advantage of multicast transmissions to update routing information ... information for unicast packets Unlike RIP -for- IP routers, OSPF routers maintain a map of the network in the link state database Updates to the network are reflected in the link state database ... subnets and hosts can be easily managed by RIP -for- IP version Specify auto-static routing with updates once a day at midnight To automatically update the routing information at a regular interval...

Ngày tải lên: 18/10/2013, 18:15

50 371 0
Module 10: RADIUS as a Solution for Remote Access

Module 10: RADIUS as a Solution for Remote Access

... engineers use a Web-based application for maintenance tracking and reporting Customers can place maintenance requests by using another Webbased application that either creates a maintenance request ... certificates Note As a best practice, specify RADIUS secrets that are at least 16 characters in length and that include upper case letters, lowercase letters, and punctuation 26 Module 10: RADIUS as ... Enhancing a RADIUS Design for Availability Optimizing a RADIUS Design for Performance Discussion: Enhancing the RADIUS Solution An organization has a geographically distributed work force that...

Ngày tải lên: 22/10/2013, 16:15

50 442 0
Social factors as a basis for treatment

Social factors as a basis for treatment

... increased demand for inpatient psychiatric care (Abas et al., 2003), and, while poverty and substance abuse are not necessarily related, poverty often increases the degree of harm that occurs at any ... therefore, which clubhouse elements are effective and which standards are necessary for success 175 Social factors as a basis for treatment Conclusion Social factors can affect the course and ... each year In 1976, Fountain House launched a national training programme and in 1988, a national expansion effort The International Center for Clubhouse Development was established in 1994, launching...

Ngày tải lên: 01/11/2013, 09:20

16 524 0
Tài liệu Module 2: TCP/IP as a Solution for Networking pdf

Tài liệu Module 2: TCP/IP as a Solution for Networking pdf

... information or explanation on optimizing IP performance IP Stack IP Stack Delay and Latency IP MTU Data Data Data Data IP TCP Data Link Link Link IP TCP Data Link Header Trailer Trailer Header ... used, you can specify IP addresses based on: Classes (A, B, C) with an associated default mask Classes with variable length subnet masks (VLSM) Classless Inter-Domain Routing (CIDR) with a specified ... Internet from all locations Support for all of the hosts, as shown in the preceding diagram Support for a mission-critical Web-based application that requires 24-hoursa-day, 7-days -a- week availability...

Ngày tải lên: 21/12/2013, 05:18

58 439 0
Tài liệu Module 3: DHCP as a Solution for IP Configuration pptx

Tài liệu Module 3: DHCP as a Solution for IP Configuration pptx

... Client an IP address and configuration information to enable IP communication The DHCP Server maintains a database that includes available and allocated IP addresses for defined subnets and the ... network traffic and IP address release As lease length Network traffic IP addresses release Increases decreases later Decreases increases sooner Note To immediately reclaim DHCP resources, you can configure ... routers for DHCP and BOOTP forwarding A mission-critical Web-based application available on a 24-hours -a- day, 7days -a- week scale No provisions exist for ensuring high availability Isolation of...

Ngày tải lên: 17/01/2014, 08:20

48 394 0
Tài liệu Module 4: DNS as a Solution for Name Resolution docx

Tài liệu Module 4: DNS as a Solution for Name Resolution docx

... databases increases as well Similarly, as the DNS zone database size increases, the length of time to resolve DNS queries increases Delegated zones divide a DNS zone database into smaller parts, ... create the subdomain for WINS under the private namespace For organizations that have the same namespace for private and public name resolution, create the subdomain for WINS at a level beneath ... zones Treated as a traditional primary zone from another BIND-based DNS server To a BIND-based DNS server, Active Directory integrated zones appear as traditional primary zones You can replicate to...

Ngày tải lên: 17/01/2014, 08:20

60 373 0
Tài liệu Learning Networks as a Means for Work Organization Development pptx

Tài liệu Learning Networks as a Means for Work Organization Development pptx

... innovations from Japan”, Organization Studies, Vol 16, No 6, pp 971-989 Nahapiet, J and Ghoshal, S (1998), “Social capital, intellectual capital and the organizational advantage”, Academy of Management ... purchases and more reliable deliveries The core company has a special VAVE team and each supplier company has a VAVE coordinator External support for the Network’s discussions, training and development ... communities are ready and willing to expand their role in an area in which they are forced in a constant search for a satisfying balance between their own scientific norms and standards and the expectations...

Ngày tải lên: 24/01/2014, 00:20

17 441 0
Tài liệu Module 5: WINS as a Solution for NetBIOS Name Resolution doc

Tài liệu Module 5: WINS as a Solution for NetBIOS Name Resolution doc

... Release, Register, Renew, Release, and Query by Unicast and Query by Unicast traffic then use Lmhosts traffic then use Lmhosts and Broadcasts and Broadcasts WINS Server Unicast reduces broadcasts ... database replication As the length of time for synchronizing redundant WINS databases increases, the probability increases that a WINS server failure will result in the use of an outdated database ... redundancy and load balancing When you use replication, all servers contain the same WINS database information Timely WINS Database Replication Highly available WINS implementation designs call for timely...

Ngày tải lên: 24/01/2014, 10:20

45 407 0
Tài liệu Module 6: NAT as a Solution for Internet Connectivity docx

Tài liệu Module 6: NAT as a Solution for Internet Connectivity docx

... Introducing NAT Designing a Functional NAT Solution Securing a NAT Solution Enhancing a NAT Design for Availability and Performance An organization has a number of sales representatives that work ... application and an inventory control application The applications are Active Directory– aware applications that store the data for the applications in a SQL Server 7.0 database How could you use NAT ... enhance availability and improve performance The following table describes how these strategies enhance availability and performance Use this strategy To enhance availability by To optimize performance...

Ngày tải lên: 24/01/2014, 10:20

34 308 0
Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

... association of the variable heavy chain (VH) with protein A was used as a surrogate for direct stability measurements The VH domains in camelid heavy chain antibodies are most similar to the classical ... Remarkably, we have found that, at least in some circumstances, a quantitative correlation to biophysical data can be obtained from a statistical analysis of selected phage populations [16] We also ... denaturant as a selective pressure to The potential for obtaining quantitative biophysical information from phage-display was suggested by a new method called alanine shotgun scanning, which analyzes...

Ngày tải lên: 19/02/2014, 12:20

7 502 0
Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc

Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc

... final model Linear discriminant analysis (LDA) This statistical multivariate method is supervised It searches for the variables containing the greatest interclass variance and the smallest intraclass ... cell spectrum and spectral areas selected by genetic algorithm A smear of about · 105 cells was dried on an area of cm2 on the germanium surface as explained in Materials and methods Wavenumbers ... et al assigned the shoulders present at 1117 and 1020 cm)1 to RNA and DNA, respectively [18] Classification by LDA Classification by LDA on spectra reduced by PCA PCA was performed on the training...

Ngày tải lên: 21/02/2014, 03:20

6 555 0
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

... UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown UAGUGAAUAGAGUUAGGCAGGGA GAAGAAGAA UAGAAGAAGAA 4995–5017 [5, 12, 38, 40] 5362–5366 ... cells Proc Natl Acad Sci USA 91, 7311–7315 32 Kamata M, Nitahara-Kasahara Y, Miyamoto Y, Yoneda Y & Aida Y (2005) Importin-alpha promotes passage through the nuclear pore complex of human immunodeficiency ... CBP coactivators J Virol 76, 9724–9734 HIV-1 alternative splicing regulation 34 Kuramitsu M, Hashizume C, Yamamoto N, Azuma A, Kamata M, Yamamoto N, Tanaka Y & Aida Y (2005) A novel role for Vpr...

Ngày tải lên: 06/03/2014, 09:22

10 434 0
Báo cáo khoa học: 2-Pyrimidinone as a probe for studying the EcoRII DNA methyltransferase–substrate interaction docx

Báo cáo khoa học: 2-Pyrimidinone as a probe for studying the EcoRII DNA methyltransferase–substrate interaction docx

... 15 to 85 C was performed at a constant rate of 0.2 Cặmin)1 Absorbance of duplexes at 260 nm was measured using Cary 50 Bio spectrophotometer (Varian, Victoria, Australia) with temperature controller ... native PAGE; (b) incubated with 1% SDS at 65 C for and analyzed by 8% native PAGE; (c) incubated with 0.8% SDS at room temperature for 10 and analyzed by 12% SDS/PAGE (Laemmli gel) For autoradiography ... scintillation uid The lter-bound radioactivity was measured on Tracor Analytic Delta 300 scintillation counter (ThermoQuest/CE Instruments, Piscataway, USA) and the amount of methylated DNA was determined...

Ngày tải lên: 07/03/2014, 15:20

9 437 0
Milk Diet As A Remedy For Chronic Disease- p1 potx

Milk Diet As A Remedy For Chronic Disease- p1 potx

... size, it has a decided advantage in ease of absorption “This breed can be traced back for 2,000 years and was always famous for dairy purposes In temperament, these animals are quiet and docile, ... Nature is always endeavoring to maintain a normal standard against any agent or condition that may attempt to alter it And when temporarily or accidentally that standard may be departed from, ... next day start with the milk as early as usual, again stop at noon, and eat a somewhat heartier meal in the evening, if the appetite calls for it Another meal that may be taken the first day is...

Ngày tải lên: 15/03/2014, 00:20

101 454 0
Relational Cloud: A Database-as-a-Service for the Cloud potx

Relational Cloud: A Database-as-a-Service for the Cloud potx

... Jajodia, S Paraboschi, and P Samarati Balancing Confidentiality and Efficiency in Untrusted Relational DBMS CCS, 2003 [7] S Das, D Agrawal, and A E Abbadi ElasTraS: An elastic transactional data ... from the graph occasional statements that scan large portions of the database and (2) sampling tuples and transactions In Relational Cloud, a new database and workload are placed arbitrarily on ... multiple partitions when the load on a database exceeds the capacity of a sin- DATABASE PARTITIONING Relational Cloud uses database partitioning for two purposes: (1) to scale a single database to...

Ngày tải lên: 16/03/2014, 16:20

6 568 0
Xem thêm
w