beware of using a fixed url

Báo cáo y học: "Prevention of Pleural Adhesions Using a Membrane Containing Polyethylene Glycol "

Báo cáo y học: "Prevention of Pleural Adhesions Using a Membrane Containing Polyethylene Glycol "

... thoracotomy by using a hyaluronate-based absorbable membran in rats [6] Also, Getman et al achieved the same effect by using haemostatic membrane [7] The present study investigates the efficacy of ... software, version 15 (SPSS, Inc., Chicago, IL) Clinical data were expressed as the median ± the standard error of mean (minimum-maximum) The non-parametric Kruskal Wallis variance analysis was ... findings are also based on the result of macroscopic and histopathological examinations However, biochemical data would elucidate physiopathological changes associated with pleural adhesion and the...

Ngày tải lên: 25/10/2012, 11:00

7 453 0
 Báo cáo y học: "Discriminating between elderly and young using a fractal dimension analysis of centre of pressure"

Báo cáo y học: "Discriminating between elderly and young using a fractal dimension analysis of centre of pressure"

... the chaotic properties of natural phenomena and the use of appropriate non-linear analysis, such as fractal analysis, in place of traditional analyses [1] A strong reason behind this paradigm ... original data can be considered appropriate Recently Parkinsonian patients (PP), spinocerebellar ataxia (SCA) patients, and healthy participants’ COP were analysed using a more traditional fractal dimension ... such as COP control, is normal then a deviation away from a fractal pattern may be indicative of a shift towards an unhealthy or less desirable control strategy The analysis of fractal patterns...

Ngày tải lên: 03/11/2012, 10:09

10 458 0
Estimation of Proper Strain Rate in the CRSC Test Using a Artificial Neural Networks

Estimation of Proper Strain Rate in the CRSC Test Using a Artificial Neural Networks

... the field data In particular, these differences are increase at the high strain rate range The reason is that ANN model has not a lot of database on the high strain rate To eliminate this effect ... realize complex mapping In order to verify the applicability of MANN model, a total of 46 data of the consolidation test results are used 43 learning data are used for training the ANN model, and ... preconsolidation pressure ratio increases as the increase of strain rate and their trends are similar to those of the previous research In the case of sample D, the predicted values of ANN model are...

Ngày tải lên: 22/03/2013, 15:01

5 517 1
A biodegradation and treatment of palm oil mill effluent (POME) using a hybrid up-flow anaerobic sludge bed (HUASB) reactor

A biodegradation and treatment of palm oil mill effluent (POME) using a hybrid up-flow anaerobic sludge bed (HUASB) reactor

... and analysis The collection of reactors effluents was done daily to be transferred to the analysis laboratory for parameters analysis The related parameters were observed and analyzed daily are ... bioreactor may be employed as an alternative of the anaerobic reactors for treating several kind of wastewater such as industrial or municipal effluents References [1] Shivayogimath CB, Ramanujam ... Habeeb, S A. , AB Aziz Bin Abdul Latiff., Zawawi Bin Daud., Zulkifli Bin Ahmad A review on granules initiation and development inside UASB Reactor and the main factors affecting granules formation...

Ngày tải lên: 05/09/2013, 16:11

8 409 0
Estimation of emissions of nonmethane organic compounds from a closed landfill site using a landfill gas emission model

Estimation of emissions of nonmethane organic compounds from a closed landfill site using a landfill gas emission model

... disposal of hazardous waste (co-disposal) Since the data available on the quantity, age, and composition of the refuse in the landfill are limited, using a more sophisticated calculation was not attempted ... dioxide are the major gases produced by biodegradation of landfill wastes [2-4, 7] According to Scheutz et al [2], the biodegradable organic material in waste includes paper, animal and vegetable matter, ... studies also indicate that the time since closure of the landfill is 42 years, the age of the landfill is 60 years, and the average annual waste acceptance rate is 1000 mg/year Given that this is a...

Ngày tải lên: 05/09/2013, 16:11

8 540 0
Optimal placement of horizontal - and vertical - axis wind turbines in a wind farm for maximum power generation using a genetic algorithm

Optimal placement of horizontal - and vertical - axis wind turbines in a wind farm for maximum power generation using a genetic algorithm

... geometric parameters shown in Table Case III has been taken from the paper of Yan et al [12] and Case III has a double rotor radius compared to Case IV so that the tip-speed ratio also doubles Again, ... [4] of the wake and apply it to determine the wake of a VAWT Now, the cross-section area of the streamtube is a square of width 2R and height H instead of a circle From the conservation of momentum, ... grid arrangement is also best in the case of a VAWT for optimal power generation Wake, power and cost modeling of a HAWT 2.1 Jensen's wake modeling of a HAWT All the results reported to date in...

Ngày tải lên: 05/09/2013, 17:03

12 636 1
Tài liệu tiếng anh Điện tử công suất mạch MERS Voltage rating reduction of magnetic power supplies using a magnetic  energy recovery switch

Tài liệu tiếng anh Điện tử công suất mạch MERS Voltage rating reduction of magnetic power supplies using a magnetic energy recovery switch

... waveforms of generated current i and capacitor voltage v by the circuit of Fig Gate signals to U and Y of the full-bridge inverter and V and X of the MERS are also shown Gate signals of MERS are shifted ... power supply and the coil Both these parts of energy pulsate and cause voltage fluctuations of the capacitors The capacitors must maintain the voltage within a range; therefore the capacitors must ... voltage rating reduction causes decreasing of the DC capacitors In general, the DC capacitors occupy large part of the power supply in volume The DC capacitors store energy as large as several...

Ngày tải lên: 15/10/2013, 16:12

4 535 0
A cross cultural study of using hedges in refusing a request in english and vietnamese

A cross cultural study of using hedges in refusing a request in english and vietnamese

... bee As cunning as a fox As fat as a big As fierce as a lion As fierce as a tiger As slippery as an eel As slow as a tortoise As slow as a snail As stink as a polecat As thick as ants As wet as a ... Vietnamese languages are rich in images and have a lot of idioms And among them, idioms using the names of animals take a large portion Both cultures share the same capabilities of thought, the same ... that they are singular and common nouns; the grammatical meaning of “beautiful, tall, short, etc” is that they are adjectives Both lexical and grammatical meaning not exist separately but always...

Ngày tải lên: 14/12/2013, 00:41

49 742 0
A study on differences of using pasive voi in english and vietnamese = nghiên cứu về sự khác nhau trong cách dùng câu bị động của tiếng anh và tiếng việt luận văn tốt nghiệp đại học

A study on differences of using pasive voi in english and vietnamese = nghiên cứu về sự khác nhau trong cách dùng câu bị động của tiếng anh và tiếng việt luận văn tốt nghiệp đại học

... categories is that the passive adds a form of the auxiliary and the past participle of the main verb At the clause level, passivization involves rearrangement of two clause elements and one addition ... A recommendation for approval or rejection is made to the Australian and New Zealand Food Standards Council (consisting of the Health Ministers of Australia and New Zealand) should not be translated ... contrast and implications for teaching and learning languages made above, I hope that this paper can help students and teachers have better knowledge and correct translations of the passive-meaning...

Ngày tải lên: 18/12/2013, 10:03

46 1,4K 6
DC bus control of variable speed wind turbine using a buck boost converter

DC bus control of variable speed wind turbine using a buck boost converter

... improved on average by 24% VI ACKNOWLEDGEMENTS This work has been supported by the LTE Hydro-Québec, Natural Resources Canada and the Natural Sciences and Engineering Research Council of Canada VII ... REFERENCES C.L Kana; M Thamodharan and A Wolf; “System management of a wind-energy converter”, IEEE Tran Power Elec, Vol.16, Issue 3, pp 375 – 381, May 2001 [2] D S Zinger and E Muljadi, “Annualized wind ... improvement using variable speeds,” IEEE Trans Ind Applicat., vol 33, pp 1444– 1447, Nov./Dec 1997 [3] A Bouscayrol, Ph Delarue and X Guillaud, “Power strategies for maximum control structure of a wind...

Ngày tải lên: 03/01/2014, 19:15

5 575 1
A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university

A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university

... years; teachers and researchers believe that motivation plays an important part in the process of acquiring an additional language because motivated students are usually those who participate actively ... have a great tendency to attract the attention of students that other forms of the mass media lack According to Subramaniyan A Nambiar (1985), “ Even the person who is totally tone deaf may at ... example, before the arrival of Mother's Day or Father's Day, the teacher can first play a song about parents, such as STRAW HAT, FATHER AND SON etc, then organize some discussion about parental...

Ngày tải lên: 29/01/2014, 10:33

39 1,1K 3
Tài liệu Characterization of the Polymorphic Behavior of an Organic Compound Using a Dynamic Thermal and X-ray Powder Diffraction Technique pptx

Tài liệu Characterization of the Polymorphic Behavior of an Organic Compound Using a Dynamic Thermal and X-ray Powder Diffraction Technique pptx

... program was complete, the trapped volatiles were analyzed using sub-ambient GC/MS TGA Conditions TGA analysis was performed on several samples using a TA 2950 TGA with a platinum pan A nitrogen atmosphere ... additional characterizations of representative samples of pure polymorphs of are given in Table Combined DSC/XRPD data, suggested forms, and additional characterizations of representative samples of ... dicarboxylic acid of molecular weight of about 400 Representative sample preparation conditions of various forms of are given in Table Note that a common starting material for the preparation of these samples...

Ngày tải lên: 14/02/2014, 03:20

16 550 0
Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt

Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt

... CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT GAGTGGAGTGGAAGGAGAAGGG CCTCTTGGTGTTGGTCTTTGC CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT ... 5¢-Forward-3¢ 5¢-Reverse-3¢ CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT GAGTGGAGTGGAAGGAGAAGGG CCTCTTGGTGTTGGTCTTTGC CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA ... CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT Average efficiency ± SD Template Optimal PCR conditions Cocktail PCR conditions DENV-1...

Ngày tải lên: 14/02/2014, 19:20

12 796 0
Tài liệu Enhancement of aesthetic treatment planning and communication using a diagnostic mock-up pptx

Tài liệu Enhancement of aesthetic treatment planning and communication using a diagnostic mock-up pptx

... correct shade for direct composite resin restorations and can serve as a practical chairside alternative to the diagnostic wax-up It can also be used to create a lingual matrix for multilayered ... material is then removed at the gingival margin using a #12 blade or a flame carbide or diamond bur The patient can immediately see and appreciate the proposed result The diagnostic mock-up can ... teeth shape and alignment and declined the periodontal surgery It was explained that her central incisors would have a squared shape and would appear shorter and wider In her case, a diagnostic...

Ngày tải lên: 19/02/2014, 17:20

5 378 0
Tài liệu Báo cáo khoa học: "Enhanced word decomposition by calibrating the decision threshold of probabilistic models and using a model ensemble" pdf

Tài liệu Báo cáo khoa học: "Enhanced word decomposition by calibrating the decision threshold of probabilistic models and using a model ensemble" pdf

... 2006) They used a natural language tagger which was trained on the output of ParaMor and Morfessor The goal was to mimic each algorithm since ParaMor is rule-based and there is no access to Morfessor’s ... the mathematical model and performed experiments on language data of the morphologically complex language Zulu We compared the performance on increasing training set sizes and analysed for each ... and agglutinating languages IEEE Transactions on Audio, Speech, and Language Processing, 17(5):956965 J Goldsmith 2001 Unsupervised learning of the morphology of a natural language Computational...

Ngày tải lên: 20/02/2014, 04:20

9 558 0
Tài liệu Báo cáo khoa học: "Sense-based Interpretation of Logical Metonymy Using a Statistical Method" pdf

Tài liệu Báo cáo khoa học: "Sense-based Interpretation of Logical Metonymy Using a Statistical Method" pdf

... -22.37 Table 1: Interpretations of Lapata and Lascarides (2003) for finish video Lapata and Lascarides (2003) extend Utiyama’s approach to interpretation of logical metonymies containing aspectual ... European Chapter of the ACL, pages 168–177, Utrecht M Lapata and A Lascarides 2003 A probabilistic account of logical metonymy Computational Linguistics, 29(2):261–315 A Lascarides and A Copestake ... interpretations similar to the one of Lapata and Lascarides Our method consists of the following steps: • Step Use the method of Lapata and Lascarides (2003) to obtain a set of candidate interpretations...

Ngày tải lên: 20/02/2014, 09:20

9 429 0
Therapeutic ultrasound as a potential male contraceptive: power, frequency and temperature required to deplete rat testes of meiotic cells and epididymides of sperm determined using a commercially available system doc

Therapeutic ultrasound as a potential male contraceptive: power, frequency and temperature required to deplete rat testes of meiotic cells and epididymides of sperm determined using a commercially available system doc

... breeders served as untreated controls Sham-treated animals underwent all preparations for ultrasound treatment as treated animals: anesthesia was administered and maintained at - 2.5% isoflurane/oxygen, ... mm tall) The bottom of this chamber was a single layer of acoustically transparent latex A single layer of acoustically transparent polypropylene mesh was held in place approximately cm above ... 5.0 d, GraphPad Software, San Diego California USA [6] If data failed Bartlett’s test for equal variances, significance was evaluated using the Kruskal-Wallis test and Dunn’s multiple comparison...

Ngày tải lên: 05/03/2014, 17:20

15 967 0
Using a Spend Analysis to Help Identify Prospective Air Force Purchasing and Supply Management Initiatives - Summary of Selected Findings potx

Using a Spend Analysis to Help Identify Prospective Air Force Purchasing and Supply Management Initiatives - Summary of Selected Findings potx

... gather and analyze spend analysis data that can lead to improved PSM practices -7- What Is aaSpend Analysis? What Is Spend Analysis? An in-depth analysis of purchases An in-depth analysis of ... They also continually manage suppliers and the supply base In sum, a spend analysis integrates internal spend data and external supplier and market data and applies analytical and benchmarking ... data, as well as Kathryn Ekberg, SAF/AQCP, who answered many of our early questions about the data We also thank RAND colleagues Donna Fossum and Larry Painter, who gave us useful guidance about...

Ngày tải lên: 06/03/2014, 16:20

105 394 0
A Disquisition on the Evils of Using Tobacco pptx

A Disquisition on the Evils of Using Tobacco pptx

... tobacco extravagantly, and only by chewing, told me that it cost him five dollars a year A young lady of my acquaintance, says her snuff costs eight dollars a year If a man pay three cents a day ... the use of intoxicating drinks and that of the stimulating narcotic, tobacco The use of tobacco almost always accompanies the use of alcoholic drinks, and it may be feared that total abstinence ... observed so many pallid faces, and so many marks of declining health; nor ever knew so many hectical habits, and consumptive affections, as of late years; and I trace this alarming inroad on young...

Ngày tải lên: 06/03/2014, 20:20

28 457 0
w