best supportive care for palliative treatment

báo cáo khoa học: " Implementing collaborative care for depression treatment in primary care: A cluster randomized evaluation of a quality improvement practice redesign" ppsx

báo cáo khoa học: " Implementing collaborative care for depression treatment in primary care: A cluster randomized evaluation of a quality improvement practice redesign" ppsx

Ngày tải lên : 10/08/2014, 11:20
... theory for the design of research on health care organizations Health Care Manage Rev 2009, 34(3):191-9 56 Smith JL, et al: Developing a national dissemination plan for collaborative care for depression: ... primary care settings represent? Med Care 2002, 40(9):761-70 doi:10.1186/1748-5908-6-121 Cite this article as: Chaney et al.: Implementing collaborative care for depression treatment in primary care: ... development of program components For example, for decision support, PDSA cycles assessed questions such as: Is the DCM’s initial assessment capturing information necessary for treatment planning? Are...
  • 15
  • 366
  • 0
Guidance on Cancer Services Improving Supportive and Palliative Care for Adults with Cancer ppt

Guidance on Cancer Services Improving Supportive and Palliative Care for Adults with Cancer ppt

Ngày tải lên : 28/03/2014, 23:20
... done? 17 C Definitions of supportive and palliative care 17 - Supportive care 18 - Palliative care 20 - Supportive and palliative care services .21 D Context, ... both palliative and supportive care are often provided by patients’ family and other carers, and not exclusively by professionals Supportive and palliative care services I18 Supportive and palliative ... strategy for palliative care services in Wales17 • the All-Wales Minimum Standards for specialist palliative care1 8B • a Cancer Information Framework and the establishment of a Cancer Information...
  • 209
  • 377
  • 0
Báo cáo y học: "Cost of acute renal replacement therapy in the intensive care unit: results from The Beginning and Ending Supportive Therapy for the Kidney (BEST Kidney) Study" pps

Báo cáo y học: "Cost of acute renal replacement therapy in the intensive care unit: results from The Beginning and Ending Supportive Therapy for the Kidney (BEST Kidney) Study" pps

Ngày tải lên : 13/08/2014, 20:21
... Committees in most centers waived the need for informed consent Where Ethics Committees or Investigational Review Boards required informed consent, we obtained formal written consent All patients who ... RRT other than for drug poisoning Patients with any dialysis treatment before admission to the ICU or patients with end-stage renal failure receiving chronic dialysis were excluded For the current ... we did not attempt to perform extensive statistical analysis Cost Srisawat et al Critical Care 2010, 14:R46 http://ccforum.com/content/14/2/R46 Page of 10 differences for nursing cost, dialysate...
  • 10
  • 453
  • 0
BETTER PALLIATIVE CARE FOR OLDER PEOPLE pot

BETTER PALLIATIVE CARE FOR OLDER PEOPLE pot

Ngày tải lên : 05/03/2014, 18:20
... response It sets out evidence for policies for palliative care for older people, arguments for integrating palliative care across health services, and models for effective care solutions that will ... (1,2) Palliative care should be offered as needs develop and before they become unmanageable Palliative care must not be something that only specialized palliative care teams, palliative care ... policies for palliative care, both for older people and for the diseases they commonly suffer from; • a lack of integration of palliative care across health care settings and services; • a lack of palliative...
  • 43
  • 449
  • 0
Best Practice Policy Statement on Cryosurgery for the Treatment of Localized Prostate Cancer pptx

Best Practice Policy Statement on Cryosurgery for the Treatment of Localized Prostate Cancer pptx

Ngày tải lên : 28/03/2014, 23:20
... 100 145 290 239 975 865 1996 1996 1999 1995 210 102 No pts 2001 2004 Cryocare Seednet Cryocare Cryocare Cryocare Cryocare NA Cryosystem NA 88 85 41 86 Erectile Dysfunction (%) 4.3 0.4 15 Incontinence ... Richard J Babaian, Endocare (C); Aaron Katz, Oncura (C), Endocare (C); Louis Pisters, Endocare (C); Martin Dineen, Abbeymoor Medical Inc (C), Endocare (C); Bryan Donnelly, Endocare (C); Katsuto Shinohara, ... overnight stay, it is an option for patients seeking shorterduration treatment of clinically organ-confined prostate cancer For patients who desire minimally invasive therapy for their intermediate disease,...
  • 51
  • 417
  • 0
Living and Dying Well with Cancer: Successfully Integrating Palliative Care and Cancer Treatment pdf

Living and Dying Well with Cancer: Successfully Integrating Palliative Care and Cancer Treatment pdf

Ngày tải lên : 28/03/2014, 23:20
... model of care, how will expanding access to palliative care affect quality of care? Will the additional services that palliative care provides result in excessive health care costs? How will palliative ... uncompensated costs of care Medicare does not reimburse for hospice care while patients receive disease-modifying treatment Although total health care costs for patients who received hospice care appear ... Quality Cancer Care and Improving Palliative Care for Cancer, document the shortcomings in care for patients with advanced, incurable illness and identify barriers to quality care at the end...
  • 32
  • 285
  • 0
Improving Palliative Care for Cancer doc

Improving Palliative Care for Cancer doc

Ngày tải lên : 30/03/2014, 12:20
... offering palliative care as an option in all clinical trials), establishing a focal point for palliative care research at the NCI, improving health care professional education about palliative care, ... symptom control, palliative care, or end-of-life research or training WHAT IS PALLIATIVE CARE? The World Health Organization (WHO) defines palliative care in cancer as the “active total care of patients ... policy; IMPROVING PALLIATIVE CARE FOR CANCER • inadequate training of health care personnel in symptom management and other palliative care skills; • inadequate standards of care and lack of accountability...
  • 79
  • 292
  • 0
báo cáo sinh học:" A systematic review of task- shifting for HIV treatment and care in Africa" potx

báo cáo sinh học:" A systematic review of task- shifting for HIV treatment and care in Africa" potx

Ngày tải lên : 18/06/2014, 17:20
... provide increased quality care for HIVpositive patients, task shifting should not be a substitute for investments in health care systems more generally [14-17], and that even the best staffing models ... Resources for Health 2009, 7:49 doi: 10.1186/1478-4491-8-8 Cite this article as: Callaghan et al., A systematic review of task- shifting for HIV treatment and care in Africa Human Resources for Health ... non-physician model of care was achieved for an additional $2.5 per capita, well within the estimated minimal basic health package costs (WHO) [44] Quality of care Provider performance is a crucial...
  • 9
  • 532
  • 0
báo cáo hóa học: " Validation of a core outcome measure for palliative care in Africa: the APCA African Palliative Outcome Scale" pptx

báo cáo hóa học: " Validation of a core outcome measure for palliative care in Africa: the APCA African Palliative Outcome Scale" pptx

Ngày tải lên : 18/06/2014, 19:20
... 3Witwatersrand Palliative Care, PO Box 212, Pimville, Soweto 1808, Johannesburg, Gauteng, South Africa 4African Palliative Care Association, PO Box 72518, Kampala, Uganda 5Hospice Palliative Care Association ... Higginson IJ: Development and validation of a core outcome measure for palliative care: the palliative care outcome scale Qual Saf Health Care 1999, 8(4):219-227 16 Bausewein C, Fegg M, Radbruch L, ... believe that a tool for paediatric palliative use is urgently needed for Africa Secondly, the translation into many languages is necessary for Africa, and while we have followed best practice, we...
  • 9
  • 477
  • 0
báo cáo khoa học: "Task shifting and integration of HIV care into primary care in South Africa: The development and content of the streamlining tasks and roles to expand treatment and care for HIV (STRETCH) intervention" ppt

báo cáo khoa học: "Task shifting and integration of HIV care into primary care in South Africa: The development and content of the streamlining tasks and roles to expand treatment and care for HIV (STRETCH) intervention" ppt

Ngày tải lên : 10/08/2014, 11:20
... assessment of eligibility for ART Those eligible for ART receive drug readiness training and are then referred to ART treatment sites in local hospitals for initiation of treatment and for threeto six-month ... shifting of aspects of HIV care to lower cadres of healthcare workers [14,15]; setting up nursedriven HIV care programmes [16]; and integration of HIV care into primary care services [17-19] These ... trial Type of facility Responsibilities for HIV care in initial ART Rollout Responsibilities for HIV care for sites in the STRETCH trial Primary care services • Voluntary counselling and testing...
  • 11
  • 497
  • 0
Báo cáo y học: " Successful treatment of HIV-associated multicentric Castleman’s disease and multiple organ failure with rituximab and supportive care: a case report" potx

Báo cáo y học: " Successful treatment of HIV-associated multicentric Castleman’s disease and multiple organ failure with rituximab and supportive care: a case report" potx

Ngày tải lên : 11/08/2014, 14:21
... rituximab treatment for HIV associated MCD Consent Written informed consent was obtained from our patient for publication of this case report A copy of the Page of written consent is available for ... who receive intravenous chemotherapy in intensive care Hence admission to ICU for specific therapy can be lifesaving The gold standard therapy for HIV-associated MCD is yet to be established Vinblastine, ... attributed to relatively simple treatment for MCD: that is rituximab; and extensive multi-organ care support on the ICU Rituximab is a newly-established therapy for MCD [1] Its efficacy has thus far...
  • 6
  • 337
  • 0
báo cáo khoa học: " Shifting paradigms: how the fight for ''''universal access to AIDS treatment and prevention'''' supports achieving ''''comprehensive primary health care for all''''" ppt

báo cáo khoa học: " Shifting paradigms: how the fight for ''''universal access to AIDS treatment and prevention'''' supports achieving ''''comprehensive primary health care for all''''" ppt

Ngày tải lên : 11/08/2014, 14:21
... commitments required for AIDS treatment Ultimately, this paradigm shift will be the best service rendered by the fight for universal access to AIDS treatment and prevention, to the fight for comprehensive ... the long-term commitment is required for increasing the health workforce as much as for AIDS treatment It takes at least three years to increase the health workforce training capacity in some lowincome ... year for medicines only, AIDS treatment remains unaffordable for countries with a government health expenditure budget of US$10 per person per year, and the realization that once started, AIDS treatment...
  • 2
  • 249
  • 0
Báo cáo y học: "Endoscopic Facet Debridement for the treatment of facet arthritic pain – a novel new technique

Báo cáo y học: "Endoscopic Facet Debridement for the treatment of facet arthritic pain – a novel new technique

Ngày tải lên : 26/10/2012, 09:32
... re-innervating the joint In this study we investigate the long-term efficacy of facet debridement for the treatment of chronic back pain originating in the facet joint MATERIALS AND METHODS Patient ... with a median period of pain relief being months The range of relief for the radiofrequency group was from zero days to 16 months for all 26 patients who underwent the radiofrequency procedure Of ... patients reported significant pain improvement for at least 36 months postoperatively This durable effect is particularly promising, given the propensity for facet joint pain to return following dorsal...
  • 4
  • 599
  • 0
Báo cáo y học: "Endoscopic thoracic laminoforaminoplasty for the treatment of thoracic radiculopathy: report of 12 case"

Báo cáo y học: "Endoscopic thoracic laminoforaminoplasty for the treatment of thoracic radiculopathy: report of 12 case"

Ngày tải lên : 26/10/2012, 09:57
... laminoforaminotomy for unilateral radiculopathy: results of a new technique in 100 cases J Neurosurg 2001; 95: 51-57 Khoo LT, Fessler RG Microendoscopic decompressive laminotomy for the treatment ... adverse events with invasive approaches Open surgical correction is the current standard of care for foraminal stenosis of cervical and lumbar vertebrae Open surgery requires a longer operative ... invasive, such as endoscopic laminoforaminoplasty, should decrease the risk of major adverse events, allow for same day hospital discharge, and decrease the need for postoperative analgesia and...
  • 3
  • 506
  • 0
BEST PRACTICE GUIDELINES FOR DEPLOYING EX8200 VIRTUAL CHASSIS CONFIGURATIONS

BEST PRACTICE GUIDELINES FOR DEPLOYING EX8200 VIRTUAL CHASSIS CONFIGURATIONS

Ngày tải lên : 28/06/2013, 08:38
... for EX8208 xe-0/0/0 to xe-7/0/7 16 through 31 for EX8216 xe-16/0/0 to xe-31/0/7 16 through 23 for EX8208 xe-16/0/0 to xe-23/0/7 32 through 47 for EX8216 xe-32/0/0 to xe-47/0/7 32 through 39 for ... through 63 for EX8216 xe-48/0/0 to xe-63/0/7 48 through 55 for EX8208 xe-48/0/0 to xe-55/0/7 Copyright © 2011, Juniper Networks, Inc IMPLEMENTATION GUIDE - Best Practice Guidelines for Deploying ... Packet Forwarding Engine (PFE) The EX8200-8XS line card offers eight ports—0 through 7—with two Copyright © 2011, Juniper Networks, Inc IMPLEMENTATION GUIDE - Best Practice Guidelines for Deploying...
  • 28
  • 536
  • 0
SMALL-SCALE MINES, THEIR CUMULATIVE ENVIRONMENTAL IMPACTS AND DEVELOPING COUNTRIES BEST PRACTICE GUIDELINES FOR WATER MANAGEMENT

SMALL-SCALE MINES, THEIR CUMULATIVE ENVIRONMENTAL IMPACTS AND DEVELOPING COUNTRIES BEST PRACTICE GUIDELINES FOR WATER MANAGEMENT

Ngày tải lên : 05/09/2013, 09:08
... Collaboration forum and co-ordination • Technical support and appropriate technology • Best practice guidelines • Improved stakeholder participation in decision-making Best Practice Guidelines for water ... stated above • Will be used by DWAF as a basis for evaluating licence applications and for drafting licence conditions • Will serve as a uniform basis for negotiations through the licensing process ... rehabilitation • Large tracts of land becoming a safety hazard (for people and livestock) The duration of these impacts are mainly long term or forever For example, many areas along the Vaal and Orange Rivers...
  • 8
  • 441
  • 0
Behavior of Nitrite Oxidizers in the Nitrification/Denitrification Process for the Treatment of Simulated Coke-Oven Wastewater

Behavior of Nitrite Oxidizers in the Nitrification/Denitrification Process for the Treatment of Simulated Coke-Oven Wastewater

Ngày tải lên : 05/09/2013, 09:38
... One of them was for DNA extraction and was washed with TE buffer at pH8.0, and stored at -20oC Another was for FISH analysis and was stored at -80oC The extraction of DNA was performed with Fast ... was employed for the detection of Nitrobacter species, and the primer set NSR1113f CCTGCTTTCAGTTGCTACCG and NSR1264r GTTTGCAGCGCTTTGTACCG ( Dionishi et al., 2002) were employed for the detection ... (2001) Different conditions for the implementation of QP-PCR was applied, and the condition was optimized In general, the higher concentration of primers can lead to the formation of primer dimers...
  • 8
  • 572
  • 0
Contact-Adsorption-Regeneration-Stabilization Process for the Treatment of Municipal Wastewater

Contact-Adsorption-Regeneration-Stabilization Process for the Treatment of Municipal Wastewater

Ngày tải lên : 05/09/2013, 09:38
... increased with the decreasing temperature either for dried sludge (Zhou, 1992; Zhou and Banks, 1993) or for activated carbon (McCreary and Snoeyink, 1980) Therefore, it is hypothesized that there existed ... L (1999) Biological wastewater treatment: Second edition, Marcel Dekker, Inc Huang J C and Li L (2000) An innovative approach to maximize primary treatment performance Water Sci and Tech., 42(12), ... taken from the incubation reactors and were then centrifuged and washed using tap water for three times Before the adsorption tests, the sludge was diluted to the required MLSS level with the same...
  • 8
  • 686
  • 0
Tài liệu Improving the quality of reproductive health care for young people doc

Tài liệu Improving the quality of reproductive health care for young people doc

Ngày tải lên : 13/02/2014, 16:20
... pre- and postnatal care for young mothers and counseling and treatment options for STIs, at existing public-sector clinics can help expand young people’s access to high-quality care Public-sector ... Health Care Needs Health care facilities need be aware of and address the full spectrum of young people’s reproductive health care needs Preventive care, such as contraception and services for preventing, ... reproductive health care for young adults and to enhance the quality of their care A wide array of changes, including addressing the social norms that keep young people from getting care, must be made...
  • 8
  • 671
  • 0
Tài liệu Long-Term Care for the Elderly: Challenges and Policy Options pptx

Tài liệu Long-Term Care for the Elderly: Challenges and Policy Options pptx

Ngày tải lên : 13/02/2014, 18:20
... cost and that the quality of care could be at risk because elderly individuals might not be well informed about their best options for care Policy reforms in long-term care will require methods ... Funding System for Long-Term Care in Canada Patients Private LTC Support Informal Caregiver Taxes Private Insurer Nursing Home or Home Care Support Public, Private For- Profit, Private Not -For- Profit ... increased use of untrained informal caregivers would place the quality of care at risk, and elderly individuals might not be well informed about their best options for care These problems could...
  • 40
  • 613
  • 0

Xem thêm