berklee press a modern method for guitar volumes 1 2 3 complete
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf
Ngày tải lên :
18/02/2014, 13:20
... primers: Aba, 5Â-ATGGACGCTGAAT
TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG
AAGCTGGTG -3 ;Abb, 5Â-GTTCACCACCAGAAGCT
GGTGTTCTTC GCTGAA GACGT GGGTTCT AACAAG
GGTGCT -3 ;Abc, 5Â-CACAACGCCACCAACCATCAGA
CCGATGATAGCACCCTTGTTAGAACCCAC -3 ;Ab-
start, ... acid
Expected
composition
Observed
composition
Asp + Asn 4 3. 9 917
Ser 2 2 .16 48
Glu + Gln 4 4.06 43
Gly 6 6. 011 7
Ala 3 3. 026 5
Val 5 5.0 8 13
Met 2 1. 76 61
Ile
a
2 1. 1 517
Leu 2 1. 9 935
Tyr 1 0.9 617 4
Phe 3 2. 928 7
His 3 2. 8 426
Lys 2 2. 027 0
Arg 1 ... than A
b40 [ 32 34 ]. The morphol-
ogy of aggregates formed after incubation times when
the aggregation had reached a maximum [5 h for
Ab(M1–40) and Ab (1 40) and 80 min for Ab(M1– 42)
and Ab (1 42) ]...
- 16
- 691
- 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
Ngày tải lên :
18/02/2014, 17:20
... tsA58T Ag cDNA carry-
ing the A4 38 V mutation were PCR-amplified from COS-7
cDNAs using the following primers: LTA-1F, 5Â-CTC
GAGATGGATAAAGTTTTAAACAGAG -3 and LTA-
1R, 5Â-TGAAGGCAAATCTCTGGAC -3 for ...
75 kDa
25 0
kDa
15 0
kDa
10 0
kDa
10 0 kDa
75 kDa
50
kDa
10 0 kDa
75 kDa
Lyve -1
Prox -1
VEGFR -3
tsA58 T Ag
/ tublin
Lyve -1 DaAPI
DaAPI Lyve -1 Prox -1
CDa 31 DaAPI
Magnetic
A
B ... Oreda B
et al. (20 03) The conditional inactivation of the
beta-catenin gene in endothelial cells causes a defective
vascular pattern and increased vascular fragility. J Cell
Biol 16 2, 11 11 11 22 .
8...
- 11
- 873
- 0
Báo cáo khoa học: "A Nonparametric Method for Extraction of Candidate Phrasal Terms" docx
Ngày tải lên :
08/03/2014, 04:22
... 0.098 0.0 43
C-Values 0.084 0.0 31
Frequency 0.0 81 0.0 21
Table 4. Bigram Scores for Lexical Association
Measures with N=5
METRIC N=50 N =10 N=5
RankRatio 0 .27 3 0 . 13 7 0 .10 3
PMI 0. 21 9 0 . 12 1 0.059 ... C-
Value and NC-Value Method. International
Journal on Digital Libraries 3 (2) :11 5 - 13 0.
Gil, A. and G. Dias. (20 0 3a) . Efficient Mining of
Textual Associations. International Conference on
Natural ... Annual Meeting
of the Association for Computational Linguistics,
pages 18 8 -19 5.
Ferreira da Silva, J. and G. Pereira Lopes (19 99). A
local maxima method and a fair dispersion
normalization for...
- 9
- 507
- 1
Báo cáo khoa học: Kinetic hybrid models composed of mechanistic and simplified enzymatic rate laws – a promising method for speeding up the kinetic modelling of complex metabolic networks pptx
Ngày tải lên :
23/03/2014, 06:20
... 10 0 10 0 10 0
Fully simplified 50.9 39 .1 17 .2 19 .2 5 .3 46 10 0 10 0 10 0
LL Hybrid 9.6 3. 3 40.4 0 .1 1.4 61 100 10 0 10 0
Fully simplified 22 .3 13 .7 41. 0 0.4 5.9 84 10 0 10 0 10 0
MA Hybrid 14 .2 3. 7 16 .2 0 .1 ... 16 .1 68 .2 0.0
PK 37 .6 37 .5 40.5 50 .2 37 .4
LDH 0.0 0.0 29 .1 92. 6 0.0
LDH(P) 1. 4 0 .1 8.4 62. 4 1. 1
ATPase 0.7 0 .1 0 .3 46.9 0.0
AK 14 .6 3. 0 18 .1 100.0 0 .3
G6PD 12 .3 9.4 22 .5 42. 8 10 .6
6PGD 27 .4 23 .3 ... 16 .2 0 .1 3. 4 10 0 91 100 10 0
Fully simplified 42. 8 34 .8 12 .9 29 3. 7 5.6 20 22 89 10 0
LLst Hybrid 95.9 40 .1 98.9 1. 9 10 .6 10 0 10 0 10 0 10 0
Fully simplified 38 3.8 69.7 14 2. 4 14 .6 14 .0 10 0 10 0 10 0 10 0
Kinetic...
- 15
- 456
- 0
USAID Supported a Wide Range of Child and Maternal Health Activities, but Lacked Detailed Spending Data and a Proven Method for Sharing Best Practices pptx
Ngày tải lên :
28/03/2014, 09:20
... 8, 839 9 ,20 7
Honduras 3 ,14 2 3 ,14 3 3 ,37 7
India 12 ,600 14 ,22 2 12 ,8 52
Indonesia 11 ,400 13 ,800 14 ,15 7
Jamaica 544 539 497
Kenya 1, 000 1, 000 989
Liberia 1, 20 0 1, 20 0 1, 5 82
Madagascar 2, 825 3, 475 3 ,28 7
Malawi ... 8,6 01
Dominican Republic 4,000 3, 8 61 3 , 23 7
El Salvador 2, 700 2, 970 2, 970
Eritrea 1, 600 5
a
0
a
Ethiopia 4,600 6,090 7 ,25 7
Ghana 3 ,20 0 3 ,20 0 2, 719
Guatemala 4 ,15 0 4, 21 5 4 ,15 8
Guinea 2 ,15 0 2 ,15 0 2, 200
Haiti ... Percent
Africa $78.6 24 .0% $88 .3 25 .4% $16 6.9 24 .7%
Asia and the Near East 79.6 24 .2 80.5 23 .2 16 0.0 23 .7
Latin America and the Caribbean 39 .0 11 .9 39 .3 11 .3 78.4 11 .6
International Partnerships 64 .2 19 .6...
- 64
- 379
- 0
Báo cáo khoa học: "A Bayesian Method for Robust Estimation of Distributional Similarities" pot
Ngày tải lên :
30/03/2014, 21:20
... 0.0854
BC
b
(0.00 02) 0. 034 5 0 .22 3 0 . 13 8 0 .10 9 0.08 73
BC
b
(0.0 016 ) 0. 035 6 0 .24 2 0 .14 8 0 .11 9 0.0955
BC
b
(0.00 32 ) 0.0 32 5 0 .22 3 0 . 13 7 0 .11 1 0.0895
BC
a
(0.0 016 ) 0. 033 7 0. 21 2 0 . 13 3 0 .10 7 0.08 63
BC
a
(0. 03 62) 0. 034 5 ... outputs.
Set A Set C
(A) 23 8,4 83 25 5 ,24 8
(B) (C) (B) (C)
Cls-JS (s1+s2) 28 2,098 17 6,706 27 3, 768 23 2,796
JS 18 3, 054 11 ,34 42 21 1 ,6 71 2 01, 21 4
BC 16 2, 758 98, 433 19 3, 508 18 9 ,34 5
BC
b
(0.0 016 ) 55, 915 54,786 ... 0. 03 32 0 .19 5 0 . 12 4 0.09 93 0.0798
Cls-JS (s1) 0.0 31 9 0 .19 5 0 . 12 2 0.0988 0.0796
Cls-JS (s2) 0. 029 5 0 .19 8 0 . 12 2 0.09 81 0.0786
Cls-JS (s1+s2) 0. 033 3 0 .20 6 0 . 12 9 0 .10 3 0.08 41
BC 0. 033 4 0. 21 1 0 . 13 1 0 .10 6...
- 10
- 472
- 0
Báo cáo khoa học: "A Unification Method for Disjunctive Feature Descriptions" pot
Ngày tải lên :
31/03/2014, 17:20
... Berkeley, California,
February 17 -19 , 19 79.
[7] Kay, M. Parsing in Functional Unification Grammar. In
D. Dowty, L. Karttunen, and A. Zwicky, editors,
Natu-
ral Language Parsing.
Cambridge ... University Press, Cam-
bridge, England, 19 85.
[8] Perelra, F. C. N. and D. H. D. Warren. Definite clause
grammars for language analysis - a survey of the formal-
ism and a comparison with augmented ... desirable properties:
1. It appUes to descriptions containing general disjunction
and non-local path expressions;
2. It delays expansion to DNF;
3. It can take advantage of fast unification algorithms...
- 8
- 361
- 0
a novel method for the synthesis of titania nanotubes using
Ngày tải lên :
05/05/2014, 15:26
... stirring and (b) ultrasonic.
S.K. Mohapatra et al. / Journal of Catalysis 24 6 (20 07) 3 62 36 9 36 7
Fig. 10 . DRUV–vis spectra of (a) O
2
annealed UAT, (b) N
2
annealed UAT,
(c) as-prepared UAT, and ... and SAT, respectively.
2. 3. Annealing of the materials
The anodized titania nanotubular arrays were annealed in a
nitrogen and oxygen atmosphere at 500
◦
Cfor6hinaCVDfur-
nace at a heating rate ... reserved.
doi :10 .10 16/j.jcat .20 06 . 12 . 020
36 4 S.K. Mohapatra et al. / Journal of Catalysis 24 6 (20 07) 3 62 36 9
3. Results and discussion
3 .1. Anodization using aqueous acidic solution
The first set of experiments was...
- 8
- 634
- 0
a novel method for the synthesis of cao nanoparticle
Ngày tải lên :
06/05/2014, 08:55
... 1) AUC /2- CEPS (2) AUC/Toluene (1) Ratio
Sam
ple
10 0.000.574 426 06 934 539 33BlankA
84.69
0.
4864
16 28 91
3
348 52
1: 10
B
61. 88
0.
35 54
12 17 91
3
426 51
1 :20
C
33 . 53
0 .19
25
836 49
43
4 32 8
1: 30
D
00.00
0
0
42
8 017
1: 40
E
M. Sadeghi ... 1) AUC /2- CEPS (2) AUC/Toluene (1) Ratiosample
10 00. 928 027 33 7 529 4585BlankA
91. 37 0.847 9 23 7 93 528 0 617 1 :10 B
75.90
0
.70 43
24 65 53
3
50069
1: 20
C
59. 31 0 .550 32 0 31 1 23 6909 51: 30 D
24 . 710 .22 938 035 935 045 61: 40E
Figure 5. GC chromatograms of 2- CEPS on CaO NPs/Polyvinylpyrrolidone ... Appl., 2, 13 00
(2 0 12 ).
[34 ] B. K. Olga, L. Isabelle, V. Alexander,
Chem. Mater., 9, 24 (19 97).
[35 ] R. Arup, B. Jayanta, Int. J. Nanosci., 10 ,
4 13 (2 011 ).
[36 ] K. Masato, K. Takekazu, T. Masahiko,...
- 12
- 705
- 0
Báo cáo hóa học: "One Step Nucleic Acid Amplification (OSNA) - a new method for lymph node staging in colorectal carcinomas" docx
Ngày tải lên :
18/06/2014, 16:20
... Micrometastases Negative
++ 27 2 2 (1)
+ 8 - 3 (2)
- 3 (2) - 13 9
Total 38 (37 ) 2 14 4 (14 2)
Numbers in brackets indicate samples after discordant sample analysis, ++:
CK19 mRNA copies/μL higher than ... Cancer 20 08, 12 2: 25 62- 7.
22 . Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N,
Hase T: Loop-mediated isothermal amplification of DNA. Nucleic Acids Res
20 00, 28 :E 63.
23 . Weitz ... colorectal cancer to
predict micrometastases. Arch Surg 20 02, 13 7 : 13 77- 83.
20 . Tsujimoto M, Nakabayashi K, Yoshidome K, Kaneko T, Iwase T, Akiyama F,
Kato Y, Tsuda H, Ueda S, Sato K, Tamaki Y,...
- 6
- 535
- 0
Báo cáo sinh học: " A general method for nested RT-PCR amplification and sequencing the complete HCV genotype 1 open reading frame" potx
Ngày tải lên :
19/06/2014, 08:20
... Laboratories, Inc. Grant numbers:
U 01 DK60 32 9 , U 01 DK 6 034 0, U 01 DK60 32 4 , U 01 DK6 034 4, U 01
DK60 32 7 , U 01 DK6 033 5, U 01 DK6 03 52, U 01 DK6 03 42, U 01 DK6 034 5,
U 01 DK6 030 9, U 01 DK6 034 6, U 01 DK6 034 9, ... A4 y
Amplification efficiency 95
a
98 93 10 0 95
Average efficiency 96 .2
Genotype 1b
Amplicon A1 x A1 y A2 A3 A4 x A4 y
Amplification efficiency 10 0 10 0 93 93 10 0 10 0
Average efficiency 97.7
a
Amplification ... times a week.
The database will be made available free of charge to inter-
ested parties.
Table 7: Amplification efficiency for patients' amplicons
Genotype 1a
Amplicon A1 A2 A3 A4 x A4 y
Amplification...
- 9
- 444
- 0
Báo cáo hóa học: " A novel method for neck coordination exercise – a pilot study on persons with chronic non-specific neck pain" docx
Ngày tải lên :
19/06/2014, 08:20
... up
Median (IQR)
p-value
NDI 22 .0 (16 .0– 31 . 5) 15 .8, ( 12 .0 33 .0) 0.0 61
SES 94.0, (85 ,1 96.5) 96 .3, (87.8–99.4) 0. 415
DASH 31 . 4, (17 .2 40.7) 19 .6, (10 .3 28 .4) 0. 038 *
TSK 13 .8, (11 ,5 20 .2) 7 .1, (3. 7 15 .0) ... MR. Amsterdam ; New York: Excerpta Medica;
19 93 :11 -19 .
27 . Huskisson EC: Measurement of pain. Lancet 19 74, 2 :11 27 -11 31 .
28 . Ware JES, K K, Kosinski M, Gandek B: SF -36 Health Survey: Man-
ual and ... (SD)
p-value
Postural sway
Ra area (cm
2
) 4 .27 ± 1. 44 3. 59 ± 1. 79 0 .38 7
Tr area (cm
2
) 1. 61 ± 0.67 1. 14 ± 0.75 0. 019 *
Cervical Rotation
ROM for left + right rotation (degrees) 14 2 ± 18 .3 14 0 ± 16 .7...
- 10
- 712
- 0
báo cáo hóa học: "A binary method for simple and accurate two-dimensional cursor control from EEG with minimal subject training" potx
Ngày tải lên :
19/06/2014, 08:20
... females and one
male, with ages ranging from 24 –55 years. Subject A was
female, age 53 years. Subject B was female, age 55 years.
Subject C was female, age 24 years. Subject D was male,
age 32 ... 43 16 93 59 91. 7% 73. 3% 72. 9%
C 14 2 18 0 18 2 34 20 10 0.0% 90.0% 90.0%
D 29 1 17 0 24 1 47 25 10 0.0% 94.4% 96.0%
Results from the four healthy subjects (one session per subject) using real hand ... an optimum channel/bin, so we used
Bhattacharyya distance plots for real movementFigure 2
Bhattacharyya distance plots for real movement. Higher values indicate greater class separability. (a) ...
- 16
- 489
- 0
báo cáo hóa học:" A general method for nested RT-PCR amplification and sequencing the complete HCV genotype 1 open reading frame" pdf
Ngày tải lên :
20/06/2014, 04:20
... Laboratories, Inc. Grant numbers:
U 01 DK60 32 9 , U 01 DK 6 034 0, U 01 DK60 32 4 , U 01 DK6 034 4, U 01
DK60 32 7 , U 01 DK6 033 5, U 01 DK6 03 52, U 01 DK6 03 42, U 01 DK6 034 5,
U 01 DK6 030 9, U 01 DK6 034 6, U 01 DK6 034 9, ... A4 y
Amplification efficiency 95
a
98 93 10 0 95
Average efficiency 96 .2
Genotype 1b
Amplicon A1 x A1 y A2 A3 A4 x A4 y
Amplification efficiency 10 0 10 0 93 93 10 0 10 0
Average efficiency 97.7
a
Amplification ... region of
hepatitis C viruses from a single patient. Gene 19 92,
11 7 :22 9 - 23 2.
13 . Higashi Y, Kakumu S, Yoshioka K, Wakita T, Mizokami M, Ohba K, Ito
Y, Ishikawa T, Takayanagi M, Nagai Y: Dynamics of...
- 9
- 442
- 0
báo cáo hóa học:" A rapid method for the generation of uniform acellular bone explants: a technical note" pot
Ngày tải lên :
20/06/2014, 04:20
... data
analysis and the preparation of the manuscript. MJS supervised the study plan-
ning, data analysis and preparation of the manuscript. All authors read and
approved the final manuscript.
Acknowledgements
The ... al., A rapid method for the generation of uniform
acellular bone explants: a technical note Journal of Orthopaedic Surgery and
Research 2 010 , 5: 32
Received: 20 November 20 09 Accepted: 10 May ... cited.Journal of Orthopaedic Surgery and Research 2 010 , 5: 32
Jähn et al. Journal of Orthopaedic Surgery and Research 2 010 , 5: 32
http://www.josr-online.com/content/5 /1/ 32
Page 2 of 4
transplantation...
- 4
- 403
- 0
Tìm thêm:
- hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam
- xác định các mục tiêu của chương trình
- xác định các nguyên tắc biên soạn
- khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn
- khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản
- khảo sát chương trình đào tạo gắn với các giáo trình cụ thể
- xác định thời lượng học về mặt lí thuyết và thực tế
- tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam
- điều tra đối với đối tượng giảng viên và đối tượng quản lí
- điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1
- khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam
- khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu
- nội dung cụ thể cho từng kĩ năng ở từng cấp độ
- xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct
- phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ
- mở máy động cơ lồng sóc
- mở máy động cơ rôto dây quấn
- các đặc tính của động cơ điện không đồng bộ
- hệ số công suất cosp fi p2
- đặc tuyến hiệu suất h fi p2