berklee a modern method for guitar volume 1 2 3
Báo cáo sinh học: " A general method for nested RT-PCR amplification and sequencing the complete HCV genotype 1 open reading frame" potx
... Laboratories, Inc. Grant numbers: U 01 DK60 32 9 , U 01 DK 6 034 0, U 01 DK60 32 4 , U 01 DK6 034 4, U 01 DK60 32 7 , U 01 DK6 033 5, U 01 DK6 03 52, U 01 DK6 03 42, U 01 DK6 034 5, U 01 DK6 030 9, U 01 DK6 034 6, U 01 DK6 034 9, ... A4 y Amplification efficiency 95 a 98 93 10 0 95 Average efficiency 96 .2 Genotype 1b Amplicon A1 x A1 y A2 A3 A4 x A4 y Amplification efficiency 10 0 10 0 93 93 10 0 10 0 Average efficiency 97.7 a Amplification ... times a week. The database will be made available free of charge to inter- ested parties. Table 7: Amplification efficiency for patients' amplicons Genotype 1a Amplicon A1 A2 A3 A4 x A4 y Amplification...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học:" A general method for nested RT-PCR amplification and sequencing the complete HCV genotype 1 open reading frame" pdf
Ngày tải lên: 20/06/2014, 04:20
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf
... primers: Aba, 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG -3 ;Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTC GCTGAA GACGT GGGTTCT AACAAG GGTGCT -3 ;Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC -3 ;Ab- start, ... acid Expected composition Observed composition Asp + Asn 4 3. 9 917 Ser 2 2 .16 48 Glu + Gln 4 4.06 43 Gly 6 6. 011 7 Ala 3 3. 026 5 Val 5 5.0 8 13 Met 2 1. 76 61 Ile a 2 1. 1 517 Leu 2 1. 9 935 Tyr 1 0.9 617 4 Phe 3 2. 928 7 His 3 2. 8 426 Lys 2 2. 027 0 Arg 1 ... than A b40 [ 32 34 ]. The morphol- ogy of aggregates formed after incubation times when the aggregation had reached a maximum [5 h for Ab(M1–40) and Ab (1 40) and 80 min for Ab(M1– 42) and Ab (1 42) ]...
Ngày tải lên: 18/02/2014, 13:20
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... tsA58T Ag cDNA carry- ing the A4 38 V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG -3 and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC -3 for ... 75 kDa 25 0 kDa 15 0 kDa 10 0 kDa 10 0 kDa 75 kDa 50 kDa 10 0 kDa 75 kDa Lyve -1 Prox -1 VEGFR -3 tsA58 T Ag / tublin Lyve -1 DaAPI DaAPI Lyve -1 Prox -1 CDa 31 DaAPI Magnetic A B ... Oreda B et al. (20 03) The conditional inactivation of the beta-catenin gene in endothelial cells causes a defective vascular pattern and increased vascular fragility. J Cell Biol 16 2, 11 11 11 22 . 8...
Ngày tải lên: 18/02/2014, 17:20
Báo cáo khoa học: "A Nonparametric Method for Extraction of Candidate Phrasal Terms" docx
... 0.098 0.0 43 C-Values 0.084 0.0 31 Frequency 0.0 81 0.0 21 Table 4. Bigram Scores for Lexical Association Measures with N=5 METRIC N=50 N =10 N=5 RankRatio 0 .27 3 0 . 13 7 0 .10 3 PMI 0. 21 9 0 . 12 1 0.059 ... C- Value and NC-Value Method. International Journal on Digital Libraries 3 (2) :11 5 - 13 0. Gil, A. and G. Dias. (20 0 3a) . Efficient Mining of Textual Associations. International Conference on Natural ... Annual Meeting of the Association for Computational Linguistics, pages 18 8 -19 5. Ferreira da Silva, J. and G. Pereira Lopes (19 99). A local maxima method and a fair dispersion normalization for...
Ngày tải lên: 08/03/2014, 04:22
The Finite Element Method Fifth edition Volume 1: The Basis Professor O.C. Zienkiewicz, CBE, FRS ppt
... matrices. If all the equations of a system are assembled, their form is K 11 a 1 K 12 a 2 ÁÁÁr 1 ÿ f 1 K 21 a 1 K 22 a 2 ÁÁÁr 2 ÿ f 2 etc: 1: 14 and it will be noted that if any displacement, ... 18 70 11 Ritz 19 09 12 ÿ ÿ " Weighted residuals Gauss 17 95 18 Galerkin 19 15 19 Biezeno±Koch 19 23 20 ÿ ÿ " Richardson 19 10 15 Liebman 19 18 16 Southwell 19 46 1 ÿÿ " Structural analogue substitution Hreniko ... expression for U in this case can be obtained from Eq. (2. 29) as U 1 2 V e T De dvol 2: 36 which becomes by Eq. (2. 2) simply U 1 2 a T V B T DB dvol a 1 2 a T Ka 2: 37 a `quadratic'...
Ngày tải lên: 14/03/2014, 15:20
Handbook of Residue Analytical Methods for Agrochemicals VOLUME 1 and VOLUME 2 doc
... method 13 17 Apparatus 13 17 Reagents 13 17 Sampling and preparation 13 17 Green tea 13 17 Fruits and vegetables 13 17 Procedure 13 18 Extraction 13 18 Cleanup 13 18 Determination 13 18 Evaluation 13 19 Method ... 13 36 Apparatus 13 37 Reagents 13 37 Sampling and preparation 13 37 Procedure 13 37 Extraction 13 37 Cleanup 13 37 Determination 13 38 Evaluation 13 38 Method 13 38 Limit of detection 13 38 Recovery 13 39 Calculation ... 13 31 Introduction 13 31 Outline of method 13 32 Apparatus 13 32 Reagents 13 33 Sample preparation 13 33 Procedure 13 33 Extraction 13 33 Cleanup 13 34 Conversion of M .A 3 and M .A 4 to corresponding fluorescent anhydride derivatives...
Ngày tải lên: 17/03/2014, 02:20
SCIENCE FOR CONSERVATORS Volume 1 An Introduction to MATERIALS Conservation Science Teaching Series pot
... Sb 12 2 magnesium Mg 24 arsenic As 75 manganese Mn 55 barium Ba 13 7 mercury Hg 2 01 boron B 11 nickel Ni 59 bromine Br 80 nitrogen N 14 cadmium Cd 11 2 oxygen O 16 calcium Ca 40 phosphorus P 31 carbon ... 83 79 76 72 68 64 61 57 54 50 47 10 0 96 91 87 83 79 76 71 67 63 60 57 53 50 46 21 100 96 91 87 83 79 75 71 67 63 60 56 52 49 46 10 0 96 91 87 83 79 75 71 67 62 59 56 51 49 45 20 10 0 96 91 87 83 ... 93 90 87 84 81 78 75 72 70 67 64 61 59 34 10 0 97 93 90 87 84 81 78 75 72 69 66 64 61 58 33 10 0 97 93 90 87 83 80 77 74 71 69 66 63 60 58 32 10 0 97 93 90 86 83 80 77 74 71 68 65 62 60 57 31 100...
Ngày tải lên: 23/03/2014, 01:20
Báo cáo khoa học: Kinetic hybrid models composed of mechanistic and simplified enzymatic rate laws – a promising method for speeding up the kinetic modelling of complex metabolic networks pptx
... 10 0 10 0 10 0 Fully simplified 50.9 39 .1 17 .2 19 .2 5 .3 46 10 0 10 0 10 0 LL Hybrid 9.6 3. 3 40.4 0 .1 1.4 61 100 10 0 10 0 Fully simplified 22 .3 13 .7 41. 0 0.4 5.9 84 10 0 10 0 10 0 MA Hybrid 14 .2 3. 7 16 .2 0 .1 ... 16 .1 68 .2 0.0 PK 37 .6 37 .5 40.5 50 .2 37 .4 LDH 0.0 0.0 29 .1 92. 6 0.0 LDH(P) 1. 4 0 .1 8.4 62. 4 1. 1 ATPase 0.7 0 .1 0 .3 46.9 0.0 AK 14 .6 3. 0 18 .1 100.0 0 .3 G6PD 12 .3 9.4 22 .5 42. 8 10 .6 6PGD 27 .4 23 .3 ... 16 .2 0 .1 3. 4 10 0 91 100 10 0 Fully simplified 42. 8 34 .8 12 .9 29 3. 7 5.6 20 22 89 10 0 LLst Hybrid 95.9 40 .1 98.9 1. 9 10 .6 10 0 10 0 10 0 10 0 Fully simplified 38 3.8 69.7 14 2. 4 14 .6 14 .0 10 0 10 0 10 0 10 0 Kinetic...
Ngày tải lên: 23/03/2014, 06:20
USAID Supported a Wide Range of Child and Maternal Health Activities, but Lacked Detailed Spending Data and a Proven Method for Sharing Best Practices pptx
... 8, 839 9 ,20 7 Honduras 3 ,14 2 3 ,14 3 3 ,37 7 India 12 ,600 14 ,22 2 12 ,8 52 Indonesia 11 ,400 13 ,800 14 ,15 7 Jamaica 544 539 497 Kenya 1, 000 1, 000 989 Liberia 1, 20 0 1, 20 0 1, 5 82 Madagascar 2, 825 3, 475 3 ,28 7 Malawi ... 8,6 01 Dominican Republic 4,000 3, 8 61 3 , 23 7 El Salvador 2, 700 2, 970 2, 970 Eritrea 1, 600 5 a 0 a Ethiopia 4,600 6,090 7 ,25 7 Ghana 3 ,20 0 3 ,20 0 2, 719 Guatemala 4 ,15 0 4, 21 5 4 ,15 8 Guinea 2 ,15 0 2 ,15 0 2, 200 Haiti ... Percent Africa $78.6 24 .0% $88 .3 25 .4% $16 6.9 24 .7% Asia and the Near East 79.6 24 .2 80.5 23 .2 16 0.0 23 .7 Latin America and the Caribbean 39 .0 11 .9 39 .3 11 .3 78.4 11 .6 International Partnerships 64 .2 19 .6...
Ngày tải lên: 28/03/2014, 09:20
Báo cáo khoa học: "A Bayesian Method for Robust Estimation of Distributional Similarities" pot
... 0.0854 BC b (0.00 02) 0. 034 5 0 .22 3 0 . 13 8 0 .10 9 0.08 73 BC b (0.0 016 ) 0. 035 6 0 .24 2 0 .14 8 0 .11 9 0.0955 BC b (0.00 32 ) 0.0 32 5 0 .22 3 0 . 13 7 0 .11 1 0.0895 BC a (0.0 016 ) 0. 033 7 0. 21 2 0 . 13 3 0 .10 7 0.08 63 BC a (0. 03 62) 0. 034 5 ... outputs. Set A Set C (A) 23 8,4 83 25 5 ,24 8 (B) (C) (B) (C) Cls-JS (s1+s2) 28 2,098 17 6,706 27 3, 768 23 2,796 JS 18 3, 054 11 ,34 42 21 1 ,6 71 2 01, 21 4 BC 16 2, 758 98, 433 19 3, 508 18 9 ,34 5 BC b (0.0 016 ) 55, 915 54,786 ... 0. 03 32 0 .19 5 0 . 12 4 0.09 93 0.0798 Cls-JS (s1) 0.0 31 9 0 .19 5 0 . 12 2 0.0988 0.0796 Cls-JS (s2) 0. 029 5 0 .19 8 0 . 12 2 0.09 81 0.0786 Cls-JS (s1+s2) 0. 033 3 0 .20 6 0 . 12 9 0 .10 3 0.08 41 BC 0. 033 4 0. 21 1 0 . 13 1 0 .10 6...
Ngày tải lên: 30/03/2014, 21:20
Báo cáo khoa học: "A Unification Method for Disjunctive Feature Descriptions" pot
... Berkeley, California, February 17 -19 , 19 79. [7] Kay, M. Parsing in Functional Unification Grammar. In D. Dowty, L. Karttunen, and A. Zwicky, editors, Natu- ral Language Parsing. Cambridge ... Press, Cam- bridge, England, 19 85. [8] Perelra, F. C. N. and D. H. D. Warren. Definite clause grammars for language analysis - a survey of the formal- ism and a comparison with augmented transition ... conjuncts may be changed. The unconditional conjuncts of a formula contain informa- tion that is more definite than the information contained in disjunctions. Thus a formula can be regarded as having...
Ngày tải lên: 31/03/2014, 17:20
a novel method for the synthesis of titania nanotubes using
... stirring and (b) ultrasonic. S.K. Mohapatra et al. / Journal of Catalysis 24 6 (20 07) 3 62 36 9 36 7 Fig. 10 . DRUV–vis spectra of (a) O 2 annealed UAT, (b) N 2 annealed UAT, (c) as-prepared UAT, and (d) ... and SAT, respectively. 2. 3. Annealing of the materials The anodized titania nanotubular arrays were annealed in a nitrogen and oxygen atmosphere at 500 ◦ Cfor6hinaCVDfur- nace at a heating rate ... reserved. doi :10 .10 16/j.jcat .20 06 . 12 . 020 36 4 S.K. Mohapatra et al. / Journal of Catalysis 24 6 (20 07) 3 62 36 9 3. Results and discussion 3 .1. Anodization using aqueous acidic solution The first set of experiments was...
Ngày tải lên: 05/05/2014, 15:26
a novel method for the synthesis of cao nanoparticle
... 1) AUC /2- CEPS (2) AUC/Toluene (1) Ratio Sam ple 10 0.000.574 426 06 934 539 33BlankA 84.69 0. 4864 16 28 91 3 348 52 1: 10 B 61. 88 0. 35 54 12 17 91 3 426 51 1 :20 C 33 . 53 0 .19 25 836 49 43 4 32 8 1: 30 D 00.00 0 0 42 8 017 1: 40 E M. Sadeghi ... 1) AUC /2- CEPS (2) AUC/Toluene (1) Ratiosample 10 00. 928 027 33 7 529 4585BlankA 91. 37 0.847 9 23 7 93 528 0 617 1 :10 B 75.90 0 .70 43 24 65 53 3 50069 1: 20 C 59. 31 0 .550 32 0 31 1 23 6909 51: 30 D 24 . 710 .22 938 035 935 045 61: 40E Figure 5. GC chromatograms of 2- CEPS on CaO NPs/Polyvinylpyrrolidone ... Appl., 2, 13 00 (2 0 12 ). [34 ] B. K. Olga, L. Isabelle, V. Alexander, Chem. Mater., 9, 24 (19 97). [35 ] R. Arup, B. Jayanta, Int. J. Nanosci., 10 , 4 13 (2 011 ). [36 ] K. Masato, K. Takekazu, T. Masahiko,...
Ngày tải lên: 06/05/2014, 08:55
Báo cáo hóa học: "One Step Nucleic Acid Amplification (OSNA) - a new method for lymph node staging in colorectal carcinomas" docx
... Micrometastases Negative ++ 27 2 2 (1) + 8 - 3 (2) - 3 (2) - 13 9 Total 38 (37 ) 2 14 4 (14 2) Numbers in brackets indicate samples after discordant sample analysis, ++: CK19 mRNA copies/μL higher than ... Cancer 20 08, 12 2: 25 62- 7. 22 . Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, Hase T: Loop-mediated isothermal amplification of DNA. Nucleic Acids Res 20 00, 28 :E 63. 23 . Weitz ... colorectal cancer to predict micrometastases. Arch Surg 20 02, 13 7 : 13 77- 83. 20 . Tsujimoto M, Nakabayashi K, Yoshidome K, Kaneko T, Iwase T, Akiyama F, Kato Y, Tsuda H, Ueda S, Sato K, Tamaki Y,...
Ngày tải lên: 18/06/2014, 16:20