Modern method for guitar 1
... musically stand alone I have not included any "old favorites" as guitar arrangements of these songs are available in many existing publications (Also, you not learn to R E A D music by playing ... accumulative process and you will find each time you review material already studied it will seem easier to play (Slow, steady practice and constant review will eventually lead to speed and accuracy.) ... mention at this point that all music presented for study on these pages is original and has been created especially for the guitar EACH composition has been designed to advance the student's musical...
Ngày tải lên: 16/08/2013, 08:28
Modern method for guitar 2
... something already learned All music is again original and has been created especially for the presentation and perfection of the lesson material Please be advised that the pages devoted to theory are ... guitar players in general As before, good luck and have fun William G Leavitt ALL SCALES (MAJ and MIN etc ) WILL BE DERIVED FROM THESE FOUR BASIC MAJOR SCALE FINGERING PATTERNS ULTIMATELY MAJOR ... POSSIBLE IN EACH POSITION WITH TYPE AND ITS' FOUR DERIVATIVE FINGERING PATTERNS - 1A, 1B, 1C, AND 1D THIS SAME FACT APPLIES TO TYPE WITH ITS' DERIVATIVES 4A, 4B, 4C, AND 4D FINGERING TYPES AND HAVE NO...
Ngày tải lên: 16/08/2013, 08:28
... SharePoint 2 010 server, and computer running SQL Server 20 08 10 23 1A- NYC-DC1 - 12 Domain controller, Microsoft SharePoint 2 010 server, and computer running SQL Server 20 08 10 23 1A- NYC-DC1 - 13 Domain ... SharePoint 2 010 server, and computer running SQL Server 20 08 10 23 1A- NYC-DC1 -10 Domain controller, Microsoft SharePoint 2 010 server, and computer running SQL Server 20 08 10 23 1A- NYC-DC1 -11 Domain ... SharePoint 2 010 server, and computer running SQL Server 20 08 10 23 1A- NYC-DC1 -14 Domain controller, Microsoft SharePoint 2 010 server, and computer running SQL Server 20 08 10 23 1A- NYC-DC1 -15 Domain...
Ngày tải lên: 04/07/2014, 13:20
... U 01 DK60 32 9 , U 01 DK 6 034 0, U 01 DK60 32 4 , U 01 DK6 034 4, U 01 DK60 32 7 , U 01 DK6 033 5, U 01 DK6 03 52, U 01 DK6 03 42, U 01 DK6 034 5, U 01 DK6 030 9, U 01 DK6 034 6, U 01 DK6 034 9, U 01 DK6 03 41 Other support: National ... Table 7: Amplification efficiency for patients' amplicons Genotype 1a Amplicon Amplification efficiency Average efficiency A1 9 5a A2 A3 98 93 96 .2 A4 x 10 0 A4 y 95 A2 A3 93 93 97.7 A4 x 10 0 A4 y 10 0 Genotype ... Virology Journal 20 05, 2: 88 http://www.virologyj.com/content /2 /1/ 88 Amplicon Amplicon 13 64 57 4995 7698 1x 1y 13 13 25 66 ORF 5’UTR 24 07 5 026 728 3 837 3 3 UTR 4x 4y 828 8 Amplicon 9 524 Amplicon Figure...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học:" A general method for nested RT-PCR amplification and sequencing the complete HCV genotype 1 open reading frame" pdf
... U 01 DK60 32 9 , U 01 DK 6 034 0, U 01 DK60 32 4 , U 01 DK6 034 4, U 01 DK60 32 7 , U 01 DK6 033 5, U 01 DK6 03 52, U 01 DK6 03 42, U 01 DK6 034 5, U 01 DK6 030 9, U 01 DK6 034 6, U 01 DK6 034 9, U 01 DK6 03 41 Other support: National ... Table 7: Amplification efficiency for patients' amplicons Genotype 1a Amplicon Amplification efficiency Average efficiency A1 9 5a A2 A3 98 93 96 .2 A4 x 10 0 A4 y 95 A2 A3 93 93 97.7 A4 x 10 0 A4 y 10 0 Genotype ... Virology Journal 20 05, 2: 88 http://www.virologyj.com/content /2 /1/ 88 Amplicon Amplicon 13 64 57 4995 7698 1x 1y 13 13 25 66 ORF 5’UTR 24 07 5 026 728 3 837 3 3 UTR 4x 4y 828 8 Amplicon 9 524 Amplicon Figure...
Ngày tải lên: 20/06/2014, 04:20
a rapid method for estiminating of noise expouse workplace
... screening and evaluation of noise damage Int J Occup Med Environ Health 19 99; 12 (2) : 18 3- 92 Maged H, Waleed E A GIS-based approach for the screening assessment of noise and vibration impacts from transit ... and SPAN in Veterans Affairs primary care settings (16 ) In this study, the positive predictive value was 25 Golmohammadi R et al: A Rapid Method for 62. 5% and negative predictive value as 73. 9% ... Children 12 13 Hamadan Province (the west of Iran) Journal of Research in Health Sciences 20 03; 3 (2) : 13 -7 Thomson WD, Evans B A new approach to vision screening in schools Ophthalmic Physiol Opt 19 99;...
Ngày tải lên: 05/09/2013, 13:23
Tài liệu Oracle Database 10g - New Features For Administrators .Vol 1 ppt
... Database: Examples 16 -11 Monitoring Flashback Database 16 - 12 Excluding Tablespaces from Flashback Database 16 - 13 Flashback Database: Considerations 16 -14 Flashing Back RESETLOGS 16 -15 Flashback ... Parameters 21 - 20 Support in SQL and Functions 21 - 21 Quote Operator q 21 - 22 UTL_MAIL Package 21 - 23 xx UTL_MAIL: Examples 21 - 24 LogMiner Enhancements 21 - 25 Enhanced Initialization Parameters 21 - 26 Faster ... Dictionary Changes 13 - 21 Database Control: Creating a Partition 13 -22 Database Control: Partition Maintenance 13 - 23 Partitioned IOT Enhancements 13 -24 Local Partitioned Index Enhancements 13 -25 Skipping...
Ngày tải lên: 16/01/2014, 18:20
Tài liệu A History of Indian Philosophy, Vol. 1 pptx
... Maitreyî, 14 Kaivalya, 15 Jâbâla, 16 Brahmabindu, 17 Ha@msa, 18 Âru@nika, 19 Garbha, 20 Nârâya@na, 21 Nârâya@na, 22 Paramaha@msa, 23 Brahma, 24 Am@rtanâda, 25 Atharvas'iras, 26 Atharvas'ikhâ, 27 Maitrâya@nî, ... Yâjñavalkya, 10 2 Varâha, 10 3 S'âthyâyanîya, 10 4 Hayagrîva, 10 5 Dattâtreya, 10 6 Garu@da, 10 7 Kalisantara@na, 10 8 Jâbâli, 10 9 Saubhâgyalak@smî, 11 0 Sarasvatîrahasya, 11 1 Bahvrca, 11 2 Muktika The ... 19 0 16 Karma, Âsrava and Nirjarâ 19 2 17 Pudgala .19 5 18 Dharma, Adharma, Âkâs 'a .19 7 19 Kâla and Samaya .19 8 20 Jaina Cosmography 19 9 21 Jaina Yoga 19 9 22 Jaina...
Ngày tải lên: 18/02/2014, 12:20
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf
... TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG -3 ; Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT -3 ; Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC -3 ; Abstart, ... composition Asp + Asn Ser Glu + Gln Gly Ala Val Met Ilea Leu Tyr Phe His Lys Arg 4 2 3 3.9 917 2 .16 48 4.06 43 6. 011 7 3. 026 5 5.0 8 13 1. 76 61 1 .15 17 1. 9 935 0.9 617 4 2. 928 7 2. 8 426 2. 027 0 0.996 52 a Ile–Ile ... mutations F19P, A2 1G, E22G, E22K, E22Q and D23N, and another six FEBS Journal 27 6 (20 09) 12 66 12 81 ª 20 09 The Authors Journal compilation ª 20 09 FEBS 12 67 Expression and purification of the amyloid...
Ngày tải lên: 18/02/2014, 13:20
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... SV40T Ag and the 3 portion of the tsA58T Ag cDNA carrying the A4 38 V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG -3 and LTA1R, ... GAGATGGATAAAGTTTTAAACAGAG -3 and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC -3 for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG -3 and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG -3 for the latter The PCR products were ... (ICAM) 2 regulates angiogenesis Blood 10 6, 16 36 16 43 23 Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (19 97)...
Ngày tải lên: 18/02/2014, 17:20
Báo cáo khoa học: "A Nonparametric Method for Extraction of Candidate Phrasal Terms" docx
... 0 .11 0 0.0 73 0.0 63 0.047 0.047 0.0 43 0.0 31 0.0 21 Table Bigram Scores for Lexical Association Measures with N=5 METRIC N=50 N =10 N=5 RankRatio 0 .27 3 0 . 13 7 0 .10 3 PMI 0. 21 9 0 . 12 1 0.059 TMI 0 . 13 7 ... Meeting of the Association for Computational Linguistics, pages 18 8 -19 5 Ferreira da Silva, J and G Pereira Lopes (19 99) A local maxima method and a fair dispersion normalization for extracting multiword ... International Journal on Digital Libraries 3 (2) :11 5 - 13 0 Gil, A and G Dias (20 0 3a) Efficient Mining of Textual Associations International Conference on Natural Language Processing and Knowledge Engineering...
Ngày tải lên: 08/03/2014, 04:22
Popular music vol[1] 2 theory and method
... illustrate the force of that last argument involves, as a minimum, the conquest of a critical space In particular, it calls for a confrontation with the defini- 20 lain Chambers tions and explanations ... Essential Frankfurt Reader, ed A Arato and E Gebhardt (Oxford, 19 78) pp 27 c-99 19 78 'On the social situation of music', Telos, 35 , pp 12 8-64 Baroni, M 19 80 'Musicologia, semiotica e critica musicale', ... posed a theoretical dilemma To what degree can specific music forms, styles and relations be argued to contain immanent cultural values and social meanings? Treating music as a particular sign...
Ngày tải lên: 15/03/2014, 13:13
Báo cáo khoa học: Kinetic hybrid models composed of mechanistic and simplified enzymatic rate laws – a promising method for speeding up the kinetic modelling of complex metabolic networks pptx
... 10 .1 9 .1 12 .1 58.7 22 .2 16 .0 32 . 6 24 .6 9.7 9.5 17 .2 16 .1 40.5 29 .1 8.4 0 .3 18 .1 22 .5 29 .1 15.7 0.0 17 .1 17.7 29 .7 20 .5 8.7 30 .5 25 .5 25 .5 25 .5 90 .1 62. 8 99.0 90.8 78 .3 99.8 99.5 97.5 33 .2 35 .2 86.7 ... 14 .6 12 .3 27 .4 3. 7 0.0 0.9 0 .2 28.6 25 .3 10 .2 33 .2 0.0 0.0 0.0 1. 3 8.8 1. 5 60.5 2. 0 1. 0 1. 7 52 .1 0.0 0.0 0 .1 0 .1 37 .5 0.0 0 .1 0 .1 3. 0 9.4 23 .3 1. 0 0.0 0 .2 0 .1 1.5 3. 6 0 .2 3. 0 0.0 0.0 0.0 10 .1 ... rate equations performed poorly (mean NRMSD 41% ) 416 2. 6 5 .1 2. 6 5 .3 1. 4 5.9 3. 4 5.6 10 .6 14 .0 10 0 10 0 10 0 46 61 84 10 0 20 10 0 10 0 10 0 10 0 10 0 10 0 10 0 10 0 91 22 10 0 10 0 10 0 10 0 10 0 10 0 10 0 10 0...
Ngày tải lên: 23/03/2014, 06:20
USAID Supported a Wide Range of Child and Maternal Health Activities, but Lacked Detailed Spending Data and a Proven Method for Sharing Best Practices pptx
... Near East 79.6 24 .2 80.5 23 .2 16 0.0 23 .7 Latin America and the Caribbean 39 .0 11 .9 39 .3 11 .3 78.4 11 .6 International Partnerships 64 .2 19 .6 72. 3 20 .8 13 6.5 20 .2 Bureau for Global Health 66.0 20 .1 ... Africa, $16 6.9 Latin America and the Caribbean, $78.5 12 % 25 % 20 % 24 % Bureau for Global Health, $ 13 3 .1 20 % International partnerships, $ 13 6.5 Asia and the Near East, $16 0.0 Total: $675.6 milliona Bureau ... GAO- 01- 25 6 (Washington, D.C.: Jan 1, 20 01) ; and Financial Management: Inadequate Accounting and System Project Controls at AID, GAO/AFMD- 93 -19 (Washington D.C.: May 24 , 19 93) 40 The State Department’s...
Ngày tải lên: 28/03/2014, 09:20
Báo cáo khoa học: "A Bayesian Method for Robust Estimation of Distributional Similarities" pot
... 0. 033 4 0. 21 1 0 . 13 1 0 .10 6 BCb (0.00 02) 0. 034 5 0 .22 3 0 . 13 8 0 .10 9 BCb (0.0 016 ) 0. 035 6 0 .24 2 0 .14 8 0 .11 9 BCb (0.00 32 ) 0.0 32 5 0 .22 3 0 . 13 7 0 .11 1 BCa (0.0 016 ) 0. 033 7 0. 21 2 0 . 13 3 0 .10 7 BCa (0. 03 62) 0. 034 5 ... 0 .24 6 0 .22 8 0 .22 3 0 .22 3 0 .22 4 0 .11 6 0 .11 6 0 .11 5 0 . 12 4 0 . 12 8 0 . 13 5 0 . 12 7 0 . 12 5 0 . 12 5 0 . 12 6 0.0855 0.08 71 0.0859 0.0 922 0.0958 0 .10 3 0.0 938 0.0 934 0.0 934 0.0949 0.0 627 0.0660 0.06 43 0.06 93 0.0 718 ... 28 2,098 18 3, 054 16 2, 758 55, 915 17 6,706 11 ,34 42 98, 433 54,786 27 3, 768 21 1 ,6 71 1 93, 508 90,4 72 2 32 , 796 2 01, 21 4 18 9 ,34 5 12 7,877 2. 91 1.80 2 .14 1. 48 and other well-known similarity measures As a smoothing...
Ngày tải lên: 30/03/2014, 21:20
Báo cáo khoa học: "A Unification Method for Disjunctive Feature Descriptions" pot
... Natural Language Parsing Cambridge University Press, Cambridge, England, 19 85 [8] Perelra, F C N and D H D Warren Definite clause grammars for language analysis - a survey of the formalism and ... grammar represent possible alternative values that some particular feature m a y have (along with the grammatical consequences entailed by choosing particular values for the feature) In the analysis ... of a formula contain information that is more definite than the information contained in disjunctions Thus a formula can be regarded as having a definite part, containing only unconditional conjuncts,...
Ngày tải lên: 31/03/2014, 17:20
modern electrochemistry 2ed 2002 vol 1 ionics - bockris, reddy & amulya
... Solvent Effects in Ion Hydration 10 1 10 2 10 3 10 6 10 7 11 0 11 4 11 4 11 7 11 9 12 0 12 1 12 1 12 1 12 2 12 2 12 4 12 4 12 6 12 6 12 7 12 7 12 7 13 0 13 2 13 3 13 4 13 8 13 9 More on Solvation Numbers ... CONTENTS 2 .15 .3 2 .15 .4 2 .15 .5 2 .15 .6 2 .15 .7 2 .15 .8 2 .15 .9 2 .15 .10 2 .15 .11 2 .15 . 12 2 .15 . 13 2 .15 .14 2 .15 .15 2 .16 2 .16 .1 2 .16 .2 2 .16 .3 2 .16 .4 2 .17 2 .17 .1 2 .17 .2 2 .17 .3 2 .17 .4 Do Oppositely Charged ... Nature of the Electrolyte and the Relevance of Ion–Ion Interactions 22 5 22 5 3 .2. 3 3 .2. 4 3. 3 3. 3 .1 3. 3 .2 3. 3 .3 3 .3. 4 3. 3.5 3. 3.6 3. 3.7 3. 3.8 3. 3.9 3. 3 .10 3. 4 3. 4 .1 22 6 22 8 22 9 The Debye–Hückel (or...
Ngày tải lên: 16/04/2014, 11:21
a novel method for the synthesis of titania nanotubes using
... Tsuchiya, T Sugishima, J.M Macak, L Taveira, S Fujimoto, H Kisch, P Schmuki, Appl Phys Lett 87 (20 05) 24 31 1 4 .1 24 31 1 4 .3 [24 ] R Asahi, T Morikawa, T Ohwaki, K Aoki, Y Taga, Science 29 3 (20 01) 26 9 2 71 ... Raja, M Misra, V.K Mahajan, T Gandhi, P Pillai, S.K Mohapatra, J Power Sources 16 1 (20 06) 14 50 14 57 [10 ] J.M Macak, H Tsuchiya, A Ghicov, P Schmuki, Electrochem Commun (20 05) 11 33 11 37 [11 ] A ... Fujishima, K Honda, Nature 23 8 (19 72) 37 38 [ 12 ] A. J Bard, Science 20 7 (19 80) 13 9 14 4 [ 13 ] J Zhao, X Wang, R Chen, L Li, Solid State Commun 13 4 (20 05) 705– 710 [14 ] C Ruan, M Paulose, O.K Varghese,...
Ngày tải lên: 05/05/2014, 15:26