behavior sociology of pages 411 415 j a piliavin pdf
Báo cáo sinh học: " Interspecies and intraspecies transmission of triple reassortant H3N2 influenza A viruses" pdf
... Tuzikov A, Bovin N, Gambaryan A, Klimov A, Castrucci MR, Donatelli I, Kawaoka Y: Early alterations of the receptor-binding properties of H1, H2, and H3 avian influenza virus hemagglutinins after ... more days Peak day of virus detection Estimated average virus titer on peak day/ml No of animals seroconverted /total inoculated HI*** average titer at 14DPI Virus isolation from swab samples A/ TK/IL/04 ... cage at DPI Tracheal swabs were collected on daily basis and were maintained in BHI media and were directly used to RNA extractions Non-inoculated negative control animals were placed in a separate...
- 9
- 431
- 0
Báo cáo hóa học: " Research Article Relations between Limit-Point and Dirichlet Properties of Second-Order Difference Operators A. Delil" pdf
... Lewis, “Spectral analysis of second order difference equations,” Journal of Mathematical Analysis and Applications, vol 63, no 2, pp 421–438, 1978 A Delil 15 [7] M K Kwong, “Conditional Dirichlet ... like to obtain some implications additional to Corollary 2.4 by imposing conditions on p, q, and w which are as weak as possible The motivation of the problem and parts (a) and (b) of the following ... throughout: R and C denote the real and complex number fields, and N is the set of nonnegative integers z denotes the complex conjugate of z ∈ C (·) and (·) represent the imaginary and real part of a complex...
- 15
- 295
- 0
Tài liệu Characterization of the Polymorphic Behavior of an Organic Compound Using a Dynamic Thermal and X-ray Powder Diffraction Technique pptx
... dicarboxylic acid of molecular weight of about 400 Representative sample preparation conditions of various forms of are given in Table Note that a common starting material for the preparation of these samples ... additional characterizations of representative samples of pure polymorphs of are given in Table Combined DSC/XRPD data, suggested forms, and additional characterizations of representative samples of ... program was complete, the trapped volatiles were analyzed using sub-ambient GC/MS TGA Conditions TGA analysis was performed on several samples using a TA 2950 TGA with a platinum pan A nitrogen atmosphere...
- 16
- 549
- 0
Tài liệu A sociology of mental health and illness Third edition pptx
... social capital and neighbourhood The relationship between poverty and mental health status Labour market disadvantage and mental health Housing and mental health Social class and mental health ... disciplines and this joint work may appear in nonsociology journals Although disciplinary silos are still often jealously protected in the academy, research in an applied and broad area like mental health ... which are stable, certain or invariant In each case, the caveat of social relativism has to be registered Judgements about health and illness (physical as well as mental) are value laden and reflect...
- 290
- 1,551
- 1
Health-related behavior and quality of life among the elderly: a population-based study pot
... 486 Health-related behavior and quality of life Lima MG et al RESUMO OBJETIVO: Analisar a associaỗóo de comportamentos saudỏveis com a qualidade de vida relacionada saỳde em idosos ... southeastern Brazil: the cities of Botucatu and Campinas; an area covering the cities of Itapecerica da Serra, Embu, and Taboóo da Serra; and the district of Butantó in the city of Sóo Paulo The sample ... domain in each study area a minimum sample size of 200 was estimated based on a prevalence of 0.5, an error of 0.10, an alpha error of 0.05 and a design effect of Considering a potential loss of...
- 9
- 507
- 0
Báo cáo y học: " Patterns of treatment seeking behavior for mental illnesses in Southwest Ethiopia: a hospital based study" docx
... Stanford Undergraduate Research Journal 2003, 2:27-31 Gater R, Almeida B, sousa E, Barrientos G, Caraveo J, Chandrashekar C, Dhadphale M, Goldberg D, Al Kathiri A, Mubbashar M, Silhan K, Thong D, ... demonstrated that age of the patient had significant statistical association with early treatment seeking behavior Somatic problems were also predictors of early treatment seeking behavior for mental ... to thank Joseph Lippi for editing this manuscript Author details Department of Health Education and Behavioral Sciences, Jimma University, Jimma, Ethiopia 2Department of Psychiatry, Jimma University,...
- 7
- 354
- 0
The force of law toward a sociology of the juridical field (Pierre Bourdieu)
... the case), that is to institute the controversy as a lawsuit, as a juridical problem that can become the object of juridically regulated debate Such a retransla-tion retains as part of the case ... militants has produced a broad acquaintance with legal rules and procedures in a large number of nonprofessionals, this circumstance paradoxically has not had the effect of causing a reappropriation ... of a body of legal specialists, and of juridical scholarship adapted to making the law an abstract and logically coherent discourse, with the development of bureaucracies and of the impersonal...
- 49
- 680
- 0
Towards a sociology of photography (Pierre Bourdieu)
... usual sense) which immediately reveals a hope or an ambition as reasonable or unreasonable, a particular commodity as accessible or inaccessible, a particular action as suitable or unsuitable ... social categories, whether these are the chances of attaining permanent employment in the case of an unqualified and uneducated Algerian subproletarian, or the chances of entering a faculty of ... false familiarity, in the individual case merely transfigure everyday banalities about temporality, eroticism and death into false essentialist analyses Because photography, apparently at least,...
- 5
- 636
- 0
Báo cáo y học: "Utility of routine chest radiographs in a medical–surgical intensive care unit: a quality assurance survey"
... pleural biopsy, thoracentesis, or other Analysis Given that medical and surgical patients often have different complications and varying lengths of stay, the data for each were analyzed separately ... Cardiac arrest Sepsis Other Post-partum complications 10 Cardiovascular (congestive heart failure, cardiac arrest) Gastrointestinal complications* Other Sepsis Cardiovascular Gastrointestinal Gastrointestinal ... Hospital, a university-affiliated hospital, over a 6month period were enrolled and prospectively evaluated Because this was an observational study, no attempt was made to alter the performance of...
- 5
- 506
- 0
Báo cáo y học: "Replacement of cisplatin with nedaplatin in a definitive 5-fluorouracil/ cisplatin-based chemoradiotherapy in Japanese patients with esophageal squamous cell carcinoma"
... toxicity of nedaplatin and 5-FU with radiation treatment for advanced esophageal carcinomas Anticancer Res 2003; 23: 3493-8 Yamada H, Maki H, Takeda Y, et al Evaluation of combined nedaplatin and ... predictive of clinical outcome of chemoradiotherapy for stage II/III esophageal squamous cell carcinoma in Japanese Am J Clin Oncol 2007; 30: 252-7 Sakaeda T, Yamamori M, Kuwahara A, et al VEGF G-115 4A ... Yamamori M, Kuwahara A, et al Pharmacokinetics and pharmacogenomics in esophageal cancer chemoradiotherapy Adv Drug Deliv Rev 2009; 61: 388-01 Miki I, Tamura T, Nakamura T, et al Circadian variability...
- 7
- 531
- 0
SIMULATION AND VERIFICATION OF PARTICLE COAGULATION DYNAMICS FOR A PULSED INPUT
... are highly porous and fractal (Jiang and Logan, 1991) The relationship between the mass and the size of a fractal aggregate can be written as m∝lD, where l is the actual length of the aggregate ... Hounslow M J. , Ryall R L and Marshall V R (1988) A discretized population balance for nucleation, growth, and aggregation AJChE Journal 34(11), 1821 –1832 Jackson G A (1998) Using fractal scaling and ... aggregate and D is the fractal dimension A fractal aggregate with D
- 6
- 509
- 0
Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR
... gacccgatgttcaagatact ctcctcccacaaatcaggac Saito et al., 2003b QMF QMR QMT (Probe) agacgcacgctcacctcaa gagcagttcacgaaatcc atacgctcttactgtttccggccgcc in this study BACT1369F PROK1492R TM1389BACT2 ... and Water Quality., 13, 61-72 Park H D., Sasaki Y., Maruyama T., Yanagisawa E., Hiraishi A and Kato K (2001) Degradation of the cyanobacterial hepatotoxin microcystin by a new bacterium isolated ... succession of blue-green algae, Microcystis, Anabaena, Oscillatoria and in lake Kasumigaura Environ.Tech., 14, 433-442 Park H.-D., Iwami C., Watanabe M F., Harada K.-I., Okino T and Hayashi H (1998)...
- 9
- 522
- 0
Formation of Aerobic Granular Sludge in a Continuous-Flow Reactor – Control Strategy for the Selection of Well-Settling Granular Sludge
... Health Association/American Water Works Association/Water Environment Federation, Washington DC, USA Tsuneda S., Nagano T., Hoshino T., Ejiri Y., Noda N and Hirata A (2003) Characterization of ... SVI gradually decreased due to aerobic granulation, as shown in Figs and As sludge settling ability increased, surface loading and aeration rates were gradually increased, and finally set at 1.8 ... (suspended biomass) to form aerobic granular sludge for all the experiments was obtained from an aerobic basin of a municipal wastewater treatment plant (Tokyo, Japan) Table - Wastewater composition...
- 8
- 481
- 0
Seasonal Changes of Shallow Aquatic Ecosystems in a Bird Sanctuary Pond
... Standard Methods for the examination of water and wastewater, 20th edition, APHA, Washington Akiyama M (ed) (1996) Algae in Lakes Shinjiko and Nakaumi, Research Circle of Algae in Lakes Shinjiko and ... 2010 Seasonal Changes of Plankton and Submerged Macrophyte The genera of Anabaena, Merismopedia, Oscillatoria, Melosira, Cyclotella, Navicula, Gyrosigma, Chlamydomonas, Synura and Euglena were ... Japanese Journal of Limnology, 71(1), 19-26 (in Japanese) Ogawa H., Kobayashi S., Nakayama K., Jin K., Igarashi S., Mikami H., Sakata K and Tsuzuki T (1997) Uric acid concentration originated...
- 9
- 430
- 0
Optimum feeding rate of solid hazardous waste in a cement kiln burner
... types of chemical and hazardous wastes vary greatly, it is difficult to specify a typical analysis and generalize about the impacts of burning of chemical and hazardous waste Some researchers have ... historical data of the system for the day of the experiment and the day before Raw meal was analyzed for oxides and sulphur content whereas precalcined meal was analyzed for degree of calcination, ... heating value, bulk density and particle size distribution The proximate analysis was carried out using a Las Navas Automatic Multiple Sample Thermogravimetric Analyzer TGA-2000 by applying different...
- 10
- 496
- 1
A computational study to investigate the effects of insulation and EGR in a diesel engine
... 92, 1983, p 3.1086 [29] Arash Nemati, Shahram Khalilarya, Samad Jafarmadar, Hassan Khatamnejhad, Vahid Fathi Numerical parametric investigation of a gasoline fuelled partially-premixed compression-ignition ... working as a faculty in the department of Mechanical Engineering at Jubail University, Jubail, Saudi Arabia He also worked as a Professor and Head of department in the Department of Mechanical Engineering, ... study of three operating conditions of engine: base line, adiabatic and also adding EGR to the initial charge of adiabatic case at two load operating conditions: a full load and a part load (50%...
- 20
- 643
- 0
Estimation of emissions of nonmethane organic compounds from a closed landfill site using a landfill gas emission model
... concentration of NMOC, the age of the landfill and the annual refuse acceptance rate For example, a comparison of the result of the probabilistic outcome of the total annual mass emission rate of ... disposal of hazardous waste (co-disposal) Since the data available on the quantity, age, and composition of the refuse in the landfill are limited, using a more sophisticated calculation was not attempted ... dioxide are the major gases produced by biodegradation of landfill wastes [2-4, 7] According to Scheutz et al [2], the biodegradable organic material in waste includes paper, animal and vegetable matter,...
- 8
- 540
- 0
CONSTRUCT VALIDATION OF THE JOB PERFORMANCE MEASUREMENT a CASE OF THE MALAYSIAN PUBLIC SERVICE AGENCIES
... Maklumat perjawatan dan pengisian sektor awam Putrajaya: Author Retrieved March, 2007, from http://www.jpa.gov.my/imapsa/Default.aspx?alias=www.jpa.gov.my/i-mapsa/perangkaan Malek, S (2006, August ... pengisian sektor awam Putrajaya: Author Retrieved March, 2007, from http://www.jpa.gov.my/imapsa/Default.aspx?alias=www.jpa.gov.my/i-mapsa/perangkaan Siddiquee, N .A (2006) “Public management ... each observed variable was used to identify each of its latent variables Exploratory factor analysis An exploratory factor analysis was carried out to examine the factorial validity of the Bahasa...
- 14
- 631
- 1
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25