becoming a functional programmer
Tài liệu Speak Without Fear: A Total System for Becoming a Natural, Confident Communicator docx
Ngày tải lên :
27/01/2014, 08:20
... husband, David, is a bass player Back in the mid-’80s, he was playing a benefit to save Broadway theaters, which were then being demolished at an alarming rate As he was waiting to go on and a number ... manager insisted on it As a supervisor, Ryan now had to give in-person reports to top management on a regular basis Every time his manager asked for an advance look at Ryan’s presentation, Ryan ... people has taught me never to assume that simply acquiring or refining a particular skill will mean that all is immediately and always well Using what you’ve learned about yourself so far as a guide...
- 65
- 455
- 0
Tài liệu Báo cáo khoa học: A functional polymorphism of apolipoprotein C1 detected by mass spectrometry docx
Ngày tải lên :
19/02/2014, 05:20
... ethnic background of at least 1000 subjects was typical of the American Midwest with 90% of European ancestry and 5% each of African and Asian ancestry An exception was the targeted analysis ... fractions were pooled, and 20 lL was applied to one channel of an SDS ⁄ polyacrylamide gel with standard ApoC1 (CalBiochem, San Diego, CA, USA) in an adjacent channel Onedimensional SDS ⁄ PAGE ... of ApoC1 A functional importance of a methyl group side chain at position 45 was also suggested by homology alignment ApoC1 from six available species shows either Ala or Thr at the comparable...
- 9
- 529
- 0
Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx
Ngày tải lên :
19/02/2014, 16:20
... follows: anti-porin from Calbiochem, anti-HA from Covance BabCo, anti-mouse and anti-rabbit secondary antibodies from Bio-Rad Laboratories and Amersham Pharmacia Biotech, respectively Antibodies against ... membranes Anti-HA and anti-porin sera were used at : 5000 dilution whereas the anti-MWFE and anti-18 kDa sera were used at : 1000 dilution Horseradish peroxidase-conjugated secondary antibodies (anti-rabbit ... with available antisera [anti-51 kDa, anti-TYKY, anti-30 kDa, anti-18 kDa (NDUFB6)] failed to reveal the presence of any complex I-specific subunits at that position We believe that the band may...
- 9
- 622
- 0
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx
Ngày tải lên :
19/02/2014, 16:20
... Kin175 (5¢-CACCAGAGCTACTTACA CTGAATTCCAGAATAATCACAAGCAAATC-3¢; sense primer) vs its complement generating pGL3b:Prm3aOCT)1*, pGL3b:Prm3abOCT)1* and pGL3e:Prm3aOCT)1*, OCT)1 * pGL3e:Prm3ab Mutation ... generating pGL3b:Prm3AP)1*, pGL3e: Prm3AP)1*, pGL3b: Prm3aAP)1*, pGL3e:Prm3aAP)1*, pGL3b:Prm3abAP)1*, pGL3e: Prm3abAP)1*, pGL3b: Prm3aaAP)1*, pGL3e:Prm3aaAP)1*, pGL3b:Prm3aaaAP)1* and pGL3e:Prm3aaaAP)1* ... pGL3b:Prm3ax & pGL3e:Prm3ax (Primer Kin177; 5¢-dGAGAGGTACCAGCTACTTACACTGAAA TGCAG-3¢, corresponding to NTs )140 to )118) (6) Prm3ac; pGL3b:Prm3ac & pGL3e:Prm3ac (Primer Kin188; 5¢-dGAGAGGTACCGAATTAATCACAAGCAA...
- 18
- 509
- 0
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc
Ngày tải lên :
07/03/2014, 12:20
... (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT ... The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on the presence of ascorbic acid in lower eukaryotes ... Saccharomyces cerevisiae D-arabinono-1,4-lactone oxidase (ALO), P54783; Candida albicans D-arabinono-1,4-lactone oxidase (ALO), O93852; Neurospora crassa, Q7SGY1; Gibberella zeae, XP_388870; Arabidopsis...
- 11
- 571
- 0
On becoming a leader
Ngày tải lên :
09/03/2014, 00:54
... nhà phân tích Salomon Smith Barney thấy rối loạn nói: “Tôi có cho Delta mua Eastern, Eastern mua Pan Am Pan Am thực theo sau United nắm giữ tất tiền mặt United, American’s Bob Crandall, trước im ... trình tiếp sau – Sanford and Son, Maude, The Jeffersons, One day at a time Mary Hartman, Mary Hartman – tạo nên cách mạng truyền hình cho người Mỹ nhìn vui vẻ xác Nhà văn xuất sắc Paddy Chayefsky ... liên quan đến việc khai man mối quan hệ lăng nhăng với Monica Lewinsky Khả khôi phục danh Clinton sau giai đoạn thoái trào suốt năm làm trị Arkansas mang lại cho ông biệt hiệu “Đ a quay trở về”...
- 230
- 512
- 0
BOY’S GUiDE TO BECOMING A TEEN potx
Ngày tải lên :
15/03/2014, 12:20
... extreme cases, they can lead to an increased risk of a heart attack or cancer Anabolic steroids can also cause acne, oily hair, high blood pressure, hair loss, and mood swings Anabolic steroids can ... formats Some content that appears in print may not be available in electronic books Library of Congress Cataloging-in-Publication Data American Medical Association boy’s guide to becoming a teen ... feet as clean as possible at all times Also wear cotton socks; socks absorb sweat from your feet Avoid shoes that are made of plastic, rubber, or other man-made materials These materials don’t allow...
- 130
- 2.2K
- 0
Melange: Creating a “Functional” Internet docx
Ngày tải lên :
15/03/2014, 22:20
... management and will continue to grow The weak hash table lies at the other extreme and is a cache that can be garbage collected and data may disappear at any time Weak references are special data structures ... better) hashes and random padding to foil traffic analysis; and (ii) classification rules for the decrypted packet payloads Figure illustrates the data flow; firstly a small chunk of data is read and ... meta-data in the packet environment and not the actual payload The payload data is always represented by a single large string that, together with its length, is shared across all of the packet...
- 14
- 161
- 0
Báo cáo khoa học: Gonadotropin-releasing hormone and ovarian cancer: a functional and mechanistic overview docx
Ngày tải lên :
16/03/2014, 04:20
... A, Ohmichi M, Kurachi H, Ikegami H, Hayakawa J, Tasaka K, Kanda Y, Nishio Y, Jikihara H, Matsuura N et al (1999) Role of mitogen-activated protein kinase ⁄ extracellular signal-regulated kinase ... T, Ohmichi M, Tasaka K, Kimura A, Kanda Y, Hayakawa J, Tahara M, Hisamoto K, Kurachi H & Murata Y (2000) Activation of the luteinizing hormone beta promoter by gonadotropin-releasing hormone requires ... disease and poor prognosis The fact that a high proportion of advanced-stage (stages III and IV) ovarian carcinomas express GnRH receptor mRNA and protein, as compared to early-stage carcinomas...
- 16
- 311
- 0
Báo cáo khóa học: Structural characterization of the human Nogo-A functional domains Solution structure of Nogo-40, a Nogo-66 receptor antagonist enhancing injured spinal cord regeneration ppt
Ngày tải lên :
16/03/2014, 16:20
... CGCGCGCGGATCCACTGGTACAAAGATTGCT-3¢ (forward) and 5¢-CGCGCGCGCCTCGAGCTAAAAT AAGTCAACTGGTTC-3¢ (reverse) A DNA fragment encoding human Nogo-66 corresponding to residues 1055–1120 of Nogo -A (Fig 1) was ... NgR antagonists Experimental procedures Cloning and expression of the Nogo -A fragments The Nogo -A cDNA (designated KIAA 0886) was obtained from the Kazusa DNA Research Institute (KazusaKamatari, ... (KazusaKamatari, Kisarazu, Chiba, Japan) A DNA fragment encoding a 182 residue Nogo -A fragment from residues 567–748 (designated as Nogo -A( 567–748); Fig 1) was generated by PCR with a pair of primers:...
- 11
- 493
- 0
Báo cáo khoa học: ERS1 encodes a functional homologue of the human lysosomal cystine transporter pptx
Ngày tải lên :
16/03/2014, 18:20
... meh1D and vma1D cells imaged in (A) mutant strains that are defective in the vacuolar (H+) ATPase (V-ATPase) that pumps protons into the lumen ([17] and Fig 5) We qualitatively measured vacuolar acidification ... USA 92, 1287– 1291 Gaxiola RA, Rao R, Sherman A, Grisafi P, Alper SL & Fink GR (1999) The Arabidopsis thaliana proton transporters, AtNhx1 and Avp1, can function in cation detoxification in yeast ... those amino acids that are invariant in an alignment of representative cystinosin-related proteins from humans (AAH32850.1), birds (Gallus gallus; XP_415851.1), flies (Drosophila melanogaster; AAM50956.1),...
- 15
- 378
- 0
Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot
Ngày tải lên :
16/03/2014, 23:20
... with a calculated average molecular mass of 57 752 Da and the a- subunit contains 808 amino acids with a calculated average molecular mass of 87 392 Da The total calculated average molecular mass ... (5¢-gccgcccatatgcaccaccaccaccaccacagcaccagtca gaactct), the reverse primer xa100– (5¢-gtggtgaattcagc cagtgtgcccttg), and pNIall2 as a template To facilitate purification of recombinant enzyme, the ... Escherichia coli NI453 (XDHAB) and NI850 (XDHABC) Property XDHAB XDHAB XDHABC XDHABC C acidovorans preparation [22] Low aeration Specific activity, UÆmg)1 Functionality, % A2 80 : A4 50 ratio FAD:aba Fe:aba...
- 11
- 584
- 0
Báo cáo Y học: A functional role of the membrane-proximal extracellular domains of the signal transducer gp130 in heterodimerization with the leukemia inhibitory factor receptor pot
Ngày tải lên :
18/03/2014, 01:20
... C46 6A( sense) 5¢-GATAAA GCACCCGCTATCACAGACTGG-3¢; C46 6A( antisense) 5¢-CCAGTCTGTGATAGCGGGTGCTTTATCTG-3¢; C49 1A( sense) 5¢-GCAGAGAGCAAAGCCTATTTGAT AACAG-3¢ and C491(antisense) 5¢-TGTTATCAAATAG GCTTTGCTCTCTG-3¢ ... AGACTGGACACATGG-3¢ and 5¢-TCGGGCCATGGC ATGCCCGGGGGTCAGAGCTGGG-3¢ for amplification of D4 of GCSFR and 5¢-TACTCTCAAGAAATG CCCGGGTCCCATGCCCCAGAG-3¢ and 5¢-GCCCAG GATGATGTGTAGCTCCCCGGGCTCTGGGGTCAA GGT-3¢ for ... PCR reactions were: pSVL(sense) 5¢-GTGTTACTT CTGCTCT-3¢; pSVL(antisense) 5¢-TCTAGTTGTGGTT TGT-3¢; C45 8A( sense) 5¢-ATACTTGAGTGGGCTGTG TTATCAG-3¢; C45 8A( antisense) 5¢-ATCTGATAACAC AGCCCACTCAAGTAT-3¢;...
- 11
- 583
- 0
Becoming a successful manager
Ngày tải lên :
21/03/2014, 17:42
... consistently characterize a mensch What Is a Professional Manager? AS YOU PROBABLY REALIZE, ACHIEVING the objectives of a successful manager is an arduous job Managing a department effectively is an ongoing ... understand people, ask appropriate questions, in an appropriate way, at an appropriate time, and in an appropriate place • Act responsibly and kindly toward yourself and others • Listen attentively ... error expands Here’s an amusing example of what can go wrong between sending and receiving a clear message And this was face-to-face, so think what can happen with distance At a restaurant in Cologne,...
- 225
- 571
- 0
Management in India: Grow from an Accidental to a Successful Manager in the IT & Knowledge IndustryA real-world, practical book for a professional in his journey to becoming a successful manager in IndiaRahul Goyalprofessional expertise distilled doc
Ngày tải lên :
23/03/2014, 13:20
... Coordinator Vishal Bodwani Proofreader Aaron Nash Kishore Shenoi Pankaj Ghanshani Indexer Tejal Daruwale Acquisition Editors Amey Kanse Kartikey Pandey Lead Technical Editor Kartikey Pandey Technical ... taking a break due to family or medical issues Disturbances can be long drawn, like the SARS (a deadly virus that spreads in the air from human-to-human) threat that created a fear of travel among ... may help achieve a balance in the team Internal attrition is very healthy Attrition may lower total costs Attrition may create space for growth Attrition helps a manager expand the network Attrition—watch...
- 328
- 4.5K
- 0
Báo cáo khoa học: The Cockayne syndrome group B protein is a functional dimer docx
Ngày tải lên :
23/03/2014, 15:20
... N-terminal S- and HIS- tags and C-terminal HIS- and HSV-tags The fragments were over expressed in E coli and purified using Ni-NTA agarose (Qiagen, Valencia, CA, USA) CSB ATPase activity The ATPase activity ... Molecular mass markers were determined by A4 40 (ferritin), NADH oxidation at A3 40 (lactate dehydrogenase, glutamate dehydrogenase), decomposition of H2O2 at A2 40 (catalase), and ATPase activity (CSB) ... Carney JP & Tainer JA (2000) Structural biology 4314 M Christiansen et al of Rad50 ATPase: ATP-driven conformational control in DNA double-strand break repair and the ABCATPase superfamily Cell...
- 9
- 273
- 0
Báo cáo khoa học: "A Functional Semantics of Natural Language Grammar" pot
Ngày tải lên :
24/03/2014, 05:21
... grammar has determined that some of the Studies of available informaion is decomposable into parts in a syntactically functional alternation have long been a highly valued activity significant way ... recognize each inquiry operator and to respond to Classify APPOINTMENT as not a question variable each one appropriately In computational terms, for a particular domain of expressive ... this can be far fewer than the total for Classify APPOINTMENT as unitary (as part of pronoun control) the grammar.) Establish that the gender of APPOINTMENT is known ...
- 10
- 248
- 0
Báo cáo khoa học: A novel plant protein disulfide isomerase family homologous to animal P5 – molecular cloning and characterization as a functional protein for folding of soybean seed-storage proteins docx
Ngày tải lên :
30/03/2014, 04:20
... TGTAAAG TGTAAAG + ) + )95 )1100 )1470 ACACacG ACACttG ACACaaG + + + + ) ) ) ) ) )140 )1100 )1596 )1632 )140 )1100 )1596 )1632 )1874 CAaaTG CAagTG CAaaTG CAaaTG CAaaTG CActTG CAttTG CAgtTG TGAGTCA ... peptide was constructed as follows The DNA fragment was amplified from GmPDIM cDNA by PCR using the primers 5¢-GACGACGACAAGATGC ACGCACTCTATGGAGC-3¢ and 5¢-GAGGAGAAGC CCGGTTCATAGCTCATCCTTGCTTGAAG-3¢ ... forward primer 5¢-CGGAACCAAAACATGC TAACATTTTC[FAM]G-3¢ (Invitrogen, Carlsbad, CA, USA) and the reverse primer 5¢-CGTTACAGGCAACTTGTTTCTCA-3¢ were used for detection of GmPDIM mRNA ER fractionation...
- 12
- 348
- 0
Báo cáo khoa học: Caenorhabditis elegans expresses a functional ArsA pptx
Ngày tải lên :
30/03/2014, 09:20
... were as follows: forward 5¢-CCGCTGCAGGAA Caenorhabditis elegans ASNA-1 AAAACGCTAAAATGGA-3¢ and reverse 5¢-CGCAAG CTTAGAACAAATTAGTTTAGT-3¢ The amplified PCR product was purified using a QIAquick ... Sb(III)-stimulated ArsA ATPase activities are not restricted to bacteria, but extend to animals by demonstrating that the asna-1 gene of the nematode, C elegans, encodes a functional ArsA ATPase whose activity ... human (hASNA-I), mouse (Asna1), and Drosophila melanogaster exhibit 46–56% identity to C elegans ASNA-1 Also, ASNA-1 contains a conserved Walker A motif, or P loop (GKGGVGKT), and a signal transduction...
- 7
- 243
- 0
Báo cáo khoa học: "A Functional Approach to Generation with TAG " pptx
Ngày tải lên :
31/03/2014, 06:20
... is a linguistic theory which states that a generated sentence is obtained as a result of a series of functional choices which are m a d e in a parallel fashion along several different functional ... Elhadad, M (1991) A contrastive evaluation of functional unification grammar for surface language generation: A case study in choice of connectives In C Paris, W Swartout, ~c W Mann (Eds.), Natural ... appropriate place in the surface structure they create A more complex case arises when an argument node is a footnode of an auxiliary tree Suppose an auxiliary tree, fl, was chosen in a region and a...
- 8
- 302
- 0