based on a paper by huang and notash 1999

... Ozaku, Masao Utiyama, and Hitoshi Isahara 2000 Named entity extraction based on a maximum entropy model and transformation rules (in Japanese) Journal of Natural Language Processing, 7(2):63–90 Takehito ... Osaka Toyota) because Japanese POS taggers know that TO-YO-TA is an organization name (a kind of proper noun) *:*:location-name, *:*:org-name -> ORGANIZATION,0,0 Since Yokohama Honda and Kyoto Sony ... According to this ordering, two candidates can have the same rank One of them might assert that a certain word is an organization’s name and another candidate might assert that it is a person’s...

Ngày tải lên: 08/03/2014, 05:20

... polarization charge (in units of Cooper pairs), where Cb and Vb are, respectively, the capacitance and voltage between the NR and the CPB island, Cg and Vg are, respectively, the gate capacitance ... signal absorption spectrum Next, we illustrate how to measure the mass of the particles landing on the NR based on the above discussions Unlike traditional mass spectrometers, nanomechanical mass ... Parametric amplification and back-action noise squeezing by a qubit-coupled nanoresonator Nano Lett 2010, 10:3990 Li JJ, Zhu KD: Plasmon-assisted mass sensing in a hybrid nanocrystal coupled to a nanomechanical...

Ngày tải lên: 20/06/2014, 22:20

... IEEE Conference on Advanced Video and Signal Based Surveillance (AVSS ’07), pp 242–247, London, UK, September 2007 [4] A Singh, S Sawan, M Hanmandlu, V K Madasu, and B C Lovell, “An abandoned ... fashion some additional specialized states can be defined Figure also shows six additional conditions on six transitions marked as an orange point on the respective transition arrows The reason ... mask based on this background model Pixel classification was made taking the pixels whose FSMs were in the states AP and NI, or in the states PAP and PAPAP for a time longer than 800 frames and...

Ngày tải lên: 21/06/2014, 07:20

... exactly as in the particular case θ = We still have a canonical isomorphism of graded algebras gr (A ) ≃ Λ and a canonical isomorphism of filtered algebras A ≃ Λ∗ , where Λ∗ denotes the algebra ... from my paper [12] As indicated by R P Stanley, his paper was motivated by a conjecture in the paper [2] by G.-N Han (see Conjecture 3.1 in [2]) Note also that examples of the Plancherel averages ... but can be made completely self-contained In particular, no information on Jack polynomials is required The argument is based on a remarkable idea due to S Kerov [5] and some considerations from...

Ngày tải lên: 08/08/2014, 12:22

... SpeA reverse primer, with SpeB overlap: 5' GAGATTTAACAACTGGTTGCTTGGTTGTTAGGTAGAC 3' SpeB forward primer, with SpeA overlap: 5' GTCTACCTAACAACCAAGCAACCAGTTGTTAAATCTC 3' SpeB reverse primer; adding ... DNA was used as a fusion partner with SpeA (L42R) that was constructed with the following oligonucleotide primers: SpeA forward primer, including NdeI site: 5' GATATACATATGCAACAAGACCCCGATCCAAGCC ... an Amber codon: Page of (page number not for citation purposes) Journal of Immune Based Therapies and Vaccines 2008, 6:8 5' GAATTCGGATCCGCTAGCCTACAACAG 3' For cloning, the SpeA (L42R) gene was...

Ngày tải lên: 11/08/2014, 10:23

... is called 'grammatical ambiguity.' Compare tables (1) and (2) for an example of grammatical ambiguity: (1) An example of grammatical ambiguity at the phrase rank, interpreting her duck as a noun ... either non-human or human For example: a Let me a pen – I’ve only got a fountain one b Let’s go and see the bears The polar ones are over on that rock (Halliday and Hasan, 1976: 97) 16 There is another ... form and elliptical one are both possible (Halliday and Hasan, 1976:167) 12 Like the nominal group, the verbal group plays an important part in English sentences In the traditional, structural and...

Ngày tải lên: 14/12/2013, 00:41

... codon usages for AGA and AGG codons are 19 and 34, respectively, and they amount to 98% among six codons for Arg The D-loops of isoacceptor tRNAUCU and tRNACCU contain nine (AGCAGGAC20aA) and ... aminoacylation reaction, the kcat and Km values for tRNAArgICG and tRNAArgUCU on the Asn106 fi Ala, Phe109 fi Ala and Gln111 fi Ala mutant proteins of S cerevisiae ArgRS are the same as those on the ... under a linear gradient of NaCl from to m gave a pure tRNAArg transcript, which was precipitated by addition of ethanol Aminoacylation reaction The aminoacylation reaction of tRNA was measured at...

Ngày tải lên: 18/02/2014, 11:20

... Fig 2) Relative background transcription was calculated from the ratios of signals for transporter mRNA and GAPDH mRNA With OCT1, OCT2, and CAT4 both vectors were analyzed alongside on a single ... constructed from at least six standards which were prepared using control cell lysates as solvent Sample analyte content was calculated from the analyte response ratio and the slope of the calibration ... K, Kanai M, Saya H, Kozu T & Berns A (2001) A novel tetracycline-dependent transactivator with E2F4 transcriptional activation domain Nucleic Acids Res 29, E23 14 Ivanova L, Brandli J, Saudan...

Ngày tải lên: 23/03/2014, 09:21

... eyes and enters a state that can perform various operations For example, the IFR can assist the user search for a program, can present information about any program on the television screen, and ... used as a basis for generating television operation commands and search expressions to access the TV program database Response statements to input statements may take various forms depending on ... problem areas References FACTS (FIPA Agent Communication Technologies and Services) A1 Work Package Available at http://sharon.cselt.it/projects/facts -a1 / Hideki Sumiyoshi, Ichiro Yamada, and Nobuyuki...

Ngày tải lên: 31/03/2014, 03:20

... [16] K T Wong and M D Zoltowski, “Self-Initiating MUSICbased direction finding and polarization estimation in spatiopolarizational beamspace,” IEEE Transactions on Antennas and Propagation, vol ... “Direction and polarization estimation using arrays with small loops and short dipoles,” IEEE Transactions on Antennas and Propagation, vol 41, no 3, pp 379–386, 1993 [4] B Hochwald and A Nehorai, ... estimation is a fundamental problem in estimation theory and its applications include radar, array signal processing, and frequency synchronization For scalar sensor array, a number of ESPRIT-based...

Ngày tải lên: 22/06/2014, 23:20

... retrieval and that would facilitate and speed up the calculations REFERENCES [1] N Iyer, S Jayanti, K Lou, Y Kalyanaraman, and K Ramani, “Three-dimensional shape searching: state-of-the-art review and ... easier if one could associate and define an invariant scalar functional from which the equations could be derived Such an approach has been developed: the scalar functional is the Lagrangian and ... location and then to compare them on the same location This is what is expressed by (12) and the a ne connection is responsible for such a parallel transportation Riemannian spaces are not conservative:...

Ngày tải lên: 22/06/2014, 23:20

... hierarchical flows such as H.263+ or MPEG-4 A source adaptive multilayered multicast (SAMM) algorithm based on feedback packets containing information on the estimated bandwidth (EB) available on ... fluctuation of the available bandwidth in the multicast tree, and at the same time the capacity to handle fluctuating LRs We have shown also that using LR and TCP-compatible measures as discriminative ... integrated in the classification A receiver that observes temporal variation may change its class during time In a stationary context, the classification would converge to a stable distribution This...

Ngày tải lên: 23/06/2014, 01:20

... diurnal non-steady state canopy and stem characteristics and their effects on calculations of instantaneous and daily average conductance sure stem Leaf and canopy conductances have been demonstrated ... an average, stand transpiration based on sap flow data from a range of tree sizes Rather, each tree would were a C,day G ground -based have to have its own conductance calculation, and the conductance ... Thus, on a deep soil, a P or pinaster Ait stand with low L showed a 4.1 Seasonal course of G C,day in relation to leaf area dynamics and soil moisture conditions Seasonal patterns in G are strongly...

Ngày tải lên: 09/08/2014, 04:20

... the anal canal Pathologe 2004, 25:171-7 Ishizone S, Koide N, Karasawa F, Akita N, Muranaka F, Uhara H, Miyagawa S: Surgical treatment for anorectal malignant melanoma: report of five cases and ... efficacy comparable to dacarbazine in a randomized trial of cutaneous melanoma, a combination of temozolomide, cisplatin, and liposomal doxorubicin in one patient with metastatic anal melanoma was used ... contributions to conception and design CNS contributed to the analysis and interpretation of data All authors read and approved the final manuscript All authors contributed equally to the final...

Ngày tải lên: 09/08/2014, 04:21

... data analysis and writing DS participated in data measurement and assisted writing SS assisted data analysis and writing Additional files The following Additional files are available online: Additional ... Data analysis was based on a viscoelastic lumped parameter model Frequency related characteristics were investigated by impedance analysis Materials and methods Patients and mechanical ventilation ... loading capacity Cve for viscoelastic energy, which can easily dissipate via a small Rve In contrast, at high pressure ranges, the situation is characterized by a small loading capacity Cve, and an...

Ngày tải lên: 13/08/2014, 20:21

... near help in times of crisis, and have lived there ever since idyllic simple and carefree rack one's brains strain to find a solution batter to damage as by heavy wear BÀI LUẬN TIẾNG ANH HAY ... TIẾNG ANH HAY THEO CHỦ ĐỀ doctor's house After what seemed to be a long winter, Jan recovered fully from her illness but Bob never recovered from his fright They moved into the little town so as...

Ngày tải lên: 12/08/2015, 21:36

... A SOLID SHELL ELEMENT BASED ON RELATIVE DISPLACEMENTS CONCEPT: THEORY AND APPLICATIONS MA YONGQIAN B.Eng (Nanjing University of Aeronautics and Astronautics, P.R.China), M.Eng.(Zhejiang University, ... M.Eng.(Zhejiang University, P.R.China) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF CIVIL ENGINEERING NATIONAL UNIVERSITY OF SINGAPORE 2006 ...

Ngày tải lên: 12/09/2015, 21:29

... Introduction The aim of the present paper is to investigate linear sampling algorithms and cubature formulas on sparse grids based on a B-spline quasi-interpolation, and their optimality for functions ... and energy H norm There is a very large number of papers on sparse grids in various problems of approximations, sampling recovery and integration with applications in data mining, mathematical ... is called a quasi-interpolation operator in C(R) There are many ways to construct quasi-interpolation operators A method of construction via Neumann series was suggested by Chui and Diamond [9]...

Ngày tải lên: 14/10/2015, 15:29

... Inflection Sridharan, A and Prakash, K 1995 Discussion on Point Method Geotechnique, 47 (1): 199-200 ‘Limitations of Conventional Analysis of Consolidation Robinson, R.G 1999 Consolidation Analysis ... on Results 2007 Diagnostic Curve Methods for Geomechanics, ASCE, (1): 75-79 of One-dimensional Consolidation Tests, Soils and Sivaram, B and Swamee, P.K 1977 A Computational Foundations, Japan, ... and Casagrande methods in the geotechnical engineering literature (e.g., Lambe and Whitman, 1969; Hossain, 1995; Sridharan and Prakash, 1995; Robinson, 1999) Based on the above (for an example,...

Ngày tải lên: 21/03/2013, 14:09

... to make this approach applicable to conventional transmissions, a many-gear transmission concept has been established Fuel economy and gear shifting effects Many approaches are known as feasible ... Based on Pattern Recognition and Learning Algorithm, 4th World Congress on Intelligent Control and Automation, China, 2002 [6] Mashadi B and Kazemkhani A A Fuzzy gear shifting strategy for manual ... Gear Total Ratio 4th Gear Total Ratio 5th Gear Total Ratio Final Drive Ratio Automatic Gearbox 1st Gear Total Ratio 2nd Gear Total Ratio 3rd Gear Total Ratio 4th Gear Total Ratio Final Drive Ratio...

Ngày tải lên: 05/09/2013, 17:03