barbara és allan pease a testbeszéd enciklopédiája
BODY LANGUAGE - ALLAN PEASE Part 1 doc
... accepting that humans are still biologically animals. Homo sapiens is a species of primate, a hairless ape that has learned to walk on two limbs and has a clever, advanced brain. Like any other ... has a ‘dead fish’ hand shake is likely to be accused of having a weak character and the chapter on hand shake techniques will explore the reason for this popular theory. But if a man has arthritis ... facial expres- sions and body language and many of Darwin’s ideas and observations have since been validated by modern researchers around the world. Since that time, researchers have noted and...
Ngày tải lên: 05/08/2014, 13:21
BODY LANGUAGE - ALLAN PEASE Part 2 pps
... move around the room, the American moving backwards away from the Japanese and the Japanese gradually moving towards the American. This was an attempt by both the American and Japanese to adjust ... Zone Distances The radius of the air bubble around suburban middle class white people living in Australia, New Zealand, England, North America and Canada is generally the same. It can be broken ... the Europeans or Americans referring to the Asians as ‘pushy’ and ‘familiar’ and Asians referring to the Europeans or Americans as ‘cold’, ‘stand-offish’ and ‘cool’. The lack of awareness of...
Ngày tải lên: 05/08/2014, 13:21
BODY LANGUAGE - ALLAN PEASE Part 4 docx
... revealed that the telling of a lie caused a tingling sensation in the delicate facial and neck tissues and a rub or scratch was required to satisfy it. This seems to be a reasonable explanation ... showed a greater frequency of hand-to-face gestures than those who told the Standard Arm-Cross Gesture Both arms are folded together across the chest as an attempt to ‘hide’ from an unfavourable ... quite amused when I pointed out that about 90 per cent of them had taken the folded arms position immediately after my verbal attack began. This clearly shows that most people will take an arms...
Ngày tải lên: 05/08/2014, 13:21
BODY LANGUAGE - ALLAN PEASE Part 5 pot
... people in Australia, New Zealand, Canada and America reveal that the standing ‘opening-up’ procedure is the same in each of these countries. Stage l: Defensive position, arms and legs crossed ... his ankles and reveal the concession. There are always people who claim that they habitually sit in the ankle lock position, or for that matter, any of the negative arm and leg clusters, because ... obvious that they were mentally debating the salesman’s point of view and many later confirmed that this had been the case. I noticed, however, that several managers had not taken this pose. After...
Ngày tải lên: 05/08/2014, 13:21
BODY LANGUAGE - ALLAN PEASE Part 6 pot
... significant; just as important is the geographical area of the person’s face and body at which you direct your gaze, as this also affects the outcome of a negotiation. These signals are transmitted ... away from each other and the lower halves of their bodies are relaxed, it would be reasonable to assume that these two males are unconsciously evaluating each other and that an attack is unlikely. ... the game away for most men, as they unwittingly tell the woman what is on their mind. This cluster has always been predominantly male, but the fact that women wear jeans and trousers has allowed...
Ngày tải lên: 05/08/2014, 13:21
e glossa tou somatos - allan barbara pease
... 't.,"U ... Μ." (JΡ,.', ...
Ngày tải lên: 14/05/2014, 10:23
Báo cáo khoa học: Molecular cloning of the Matrix Gla Protein gene from Xenopus laevis Functional analysis of the promoter identifies a calcium sensitive region required for basal activity doc
... the transcription initiation site a TATA- like sequence (TAAATA) is located between base pairs )28 and )23. A CCAAT-consensus box is located at )86 bp (CCAAT), a reverse CCAAT motif lies at )825 ... stranded oligonucleotides spanning the region from )70 to )36 of t he xMGP promoter (5Â-GATCCAGGGGAGGGAAAACAAGGA GATGAGGAGGTGTGGT-3Â,and5Â-GATCTACCA CACCTCCTCATCTCCTTGTTTTCCCTCCCCTG-3Â) as BamHI/BglII ... constructs )180/)36TATALUC and )180/)72TATALUC were gen- erated by PCR amplification with a common, sense oligonucleotide ( 5Â-CG GGATCCCAATCTGTTGCTAA TTAGG-3Â)andthe3Â specic oligonucleotides (5Â-GA AGATCTACCACACCTCCTCATCTCC-3Â)...
Ngày tải lên: 08/03/2014, 10:20
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc
... of action; peptide–membrane interaction; proteomics Correspondence M. L. Mangoni, Unita ` di Diagnostica Molecolare Avanzata, II Facolta ` di Medicina e Chirurgia, Azienda Ospedaliera S. Andrea, via ... fluorescein isothiocyanate–dextran of 4 kDa average molecular mass; FITC-D 10, fluorescein isothiocyanate–dextran of 10 kDa average molecular mass; FITC-D 40, fluorescein isothiocyanate–dextran of 40 kDa average ... Universita ` di Roma Tor Vergata, Rome, Italy 4 Dipartimento di Biologia di Base ed Applicata, Universita ` de L’Aquila, Italy Keywords frog skin antimicrobial peptides; Gram-negative bacteria; mode...
Ngày tải lên: 16/03/2014, 00:20
Báo cáo khoa học: A novel, promoter-based, target-specific assay identifies 2-deoxy-D-glucose as an inhibitor of globotriaosylceramide biosynthesis docx
... synthase gene; Gb4, globotetraosylceramide (GalNAcb1,3Gala1,4LacCer); GD 1a, NeuAca2,3Galb1,3GalNAcb1,4(NeuAca2,3)LacCer; GD1b, Galb1,3GalNAcb1,4(NeuAca2,8NeuAca2,3)LacCer; GM1, Galb1,3GalNAcb1,4 (NeuAca2,3)LacCer; ... Ishii A, Ohta M, Watanabe Y, Matsuda K, Ishiyama K, Sakoe K, Nakamura M, Inokuchi J, Sanai Y & Saito M (1998) Expression cloning and functional char- acterization of human cDNA for ganglioside ... Function Analysis Team, Health Technology Research Center, National Institute of Advanced Industrial Science and Technology (AIST), 2217-14 Hayashi, Takamatsu, Kagawa 761-0395, Japan Fax: +81...
Ngày tải lên: 30/03/2014, 01:20
Báo cáo khoa học: An antimicrobial peptide tachyplesin acts as a secondary secretagogue and amplifies lipopolysaccharide-induced hemocyte exocytosis potx
... 276, 27166–27170. 26 Kawabata S, Nagayama R, Hirata M, Shigenaga T, Agarwala KL, Saito T, Cho J, Nakajima H, Takagi T & Iwanaga S (1996) Tachycitin, a small granular com- ponent in horseshoe crab hemocytes, ... lipid A analogues and acidic phospholipids. Eur J Biochem 176, 89–94. 21 Nakamura T, Furunaka H, Miyata T, Tokunaga F, Muta T & Iwanaga S (1988) Tachyplesin, a class of antimicrobial peptide ... An antimicrobial peptide tachyplesin acts as a secondary secretagogue and amplifies lipopolysaccharide-induced hemocyte exocytosis Aya Ozaki 1 , Shigeru Ariki 1 and Shun-ichiro Kawabata Department...
Ngày tải lên: 30/03/2014, 20:20
Báo cáo Y học: A single charged surface residue modifies the activity of ikitoxin, a beta-type Na+ channel toxin from Parabuthus transvaalicus doc
... ikitoxin, a beta-type Na + channel toxin from Parabuthus transvaalicus A. Bora Inceoglu 1, *, Yuki Hayashida 2 , Jozsef Lango 3 , Andrew T. Ishida 2 and Bruce D. Hammock 1 1 Department of Entomology and ... software for mutation, energy minimization and electrochemical surface calculation. RESULTS The separation obtained on the magic bullet C4 column was identical to that obtained on a Vydac analytical ... against insects was tested by injecting blowfly and cabbage looper larvae. All animal care and experimental protocols conformed to the guidelines of the Animal Use and Care Administrative Advisory Committee...
Ngày tải lên: 31/03/2014, 08:20
pease, r. a. (1991) troubleshooting analog circuits
... Problem Area A few years ago we had so many nagging little troubles with band-gap reference circuits at National, that I decided (unilaterally) to declare myself “Czar of Band Gaps.” The main ... equipment that you may find useful. Logic analyzers, impedance analyzers, spectrum analyzers, program- mable current pumps, capacitance meters and testers, and pulse generators can all ease various ... than a DVM? Well, the analog voltmeter usually has inferior accuracy and resolution, but when you watch an ordinary analog voltmeter your eye can detect a trend or rate-of-change that may...
Ngày tải lên: 18/04/2014, 12:24
