bao cao the helpdesk system

Báo cáo " The Vietnamese Wetlands Classification System " potx

Ngày tải lên : 14/03/2014, 15:20

... classes or their combinations allow them to be readily identified in the field and then delineated on maps. The system is based upon an ʺexpert‐ based approachʺ in which the user ... principles. Furthermore, the system is intended to be used for any purpose at any geographical scale. The generalized key for the wetland types aim to help the user of the classification ... to revise and complete the VWCS. 99 2. The Vietnamese Wetlands Classification System The structure of VWCS is hierarchical and progresses from Systems at the most general level, to Sub‐systems, ...

8
369
0

Báo cáo " The development of financial systems of ASEAN-5 and Vietnam: A comparative analysis " potx

Ngày tải lên : 14/03/2014, 17:20

... system into the region and the world, Vietnam should consider ASEAN-5 countries as the navigators and learn the lessons from the ASEAN-5 The paper also explores that on the way to integrate the ... the banking system often developed first, and then the money market and capital market were introduced gradually as a supplement to the banking system both in ASEAN-5 and Vietnam Indeed, in the ... signal when the economic performance of other sectors goes down (as the consequences of crises), affecting the economic performance of the banking sectors Structural changes in the banking system...

13
505
0

Báo cáo khoa học: Systemic RNAi of the cockroach vitellogenin receptor results in a phenotype similar to that of the Drosophila yolkless mutant ppt

Ngày tải lên : 16/03/2014, 14:20

... in the cortex of the basal oocyte (Fig 5) The adult shows a similar pattern, although towards the end of the ﬁrst gonadotrophic cycle, the BgVgR begins to accumulate also in the cortex of the ... during both the ﬁrst gonadotrophic cycle and the period of ootheca transport Ovarian BgVgR mRNA levels appeared high at the beginning of the last nymphal instar, steadily declining along the instar, ... females (n ¼ 12) mated and had spermatozoids in the spermathecae However, they resulted sterile, either not producing ootheca (17%), or producing a small ootheca (83%) containing between and 18 nonviable...

11
414
0

Báo cáo khoa học: "SYSTEMIC GRAMMAR IN COMPUTATION: THE NIGEL CASE" ppt

Ngày tải lên : 18/03/2014, 02:20

... An example of a system is given below in Figure the systemic factoring of the sentence generation process is due to the organization of systemic grammar, Together the systems of the grammar constitute ... network of There are two simultaneous factorings that cross-cut: systems: The features that are the output of one system are part of the entry conditions of other systems The network as a whole The ... 1: The moodsysteminEnglish £59 The feature Indicative is the entry condition to the system of IndicativeMood where the options are Declarativ@ and Interroaativ¢ There is an additional step The...

10
375
0

Báo cáo "The dependence of the nonlinear absorption coefficient of strong electromagnetic waves caused by electrons confined in rectangular quantum wires on the temperature of the system" doc

Ngày tải lên : 22/03/2014, 11:20

... is influenced by other parameters of the system, such as the size Lx and Ly of wire, the intensity E0 of the strong electromagnetic wave Specifically, when the intensity E0 of the strong electromagnetic ... that the absorption coefficient depends strongly and nonlinearly on the temperature T of the system As the temperature increases the nonlinear absorption coefficient increases until it reached the ... the maximum value (peak) and then it decreases At different values of the size Lx and Ly of wire the temperature T of the system at which the absorption coefficient is the maximum value has different...

6
414
2

Báo cáo sinh học: "Systemic 5-fluorouracil treatment causes a syndrome of delayed myelin destruction in the central nervous system" doc

Ngày tải lên : 06/08/2014, 18:21

... chemotherapy or if they represent a combination of the response to chemotherapy and, for example, physiological changes caused by the body’s reaction to the presence of a tumor In addition, the ... seen in the CC of the control; (b) in the CC from a 5-FU-treated animal, the cellular density in the CC has decreased markedly (e,f) The expression of MBP seen in control animals (e) (the fiber-like ... contribute to the effects of chemotherapy on cognition The ability of irradiation to the CNS to suppress the generation of new neurons in the hippocampus has been suggested to be relevant to the understanding...

22
320
0

Báo cáo y học: "Systemic lupus erythematosus and the type I interferon system" docx

Ngày tải lên : 09/08/2014, 01:21

... obviously further raise the question of whether the type I IFN system could be involved in the etiopathogenesis of naturally occurring SLE The type I IFN system The type I IFN system comprises the inducers ... in vitro by the inhibition of endosomal acidification/maturation [23] The proposed role of the type I IFN system in SLE suggests further therapeutic targets for the inhibition of the IFN-α production ... intriguing observations on the type I IFN system that suggest a key role for NIPCs/PDCs, and the IFN-α that they produce, in the etiopathogenesis of SLE They include the observed ability of IFN-α...

8
420
0

Báo cáo y học: "Systemic TNF blockade does not modulate synovial expression of the pro-inflammatory mediator HMGB1 in rheumatoid arthritis patients – a prospective clinical study" ppt

Ngày tải lên : 09/08/2014, 10:23

... http://arthritis-research.com/content/10/2/R33 Figure study the therapeutic effects of systemic infliximab therapy on the synovial expression of other important pro-inflammatory molecules [38,47] Infliximab treatment in another small cohort ... log2-scale The last bar to the right represents the average value for the whole group and the standard deviation is indicated by whiskers UA, HEH, A-KU, ES and CG designed the study EaK performed the ... GATCCACAGCAACTCCAGAA The volume was adjusted to 15.5 μl using RNase-free water, and the mixture was then incubated for 10 minutes at 70°C to denature the total RNA The sample was then incubated for...

8
529
0

Báo cáo y học: "Systematic detection of putative tumor suppressor genes through the combined use of exome and transcriptome sequencin" ppt

Ngày tải lên : 09/08/2014, 22:23

14
380
0

Báo cáo y học: " Systemic Epstein-Barr-virus-positive T cell lymphoproliferative childhood disease in a 22-year-old Caucasian man: A case report and review of the literature" docx

Ngày tải lên : 10/08/2014, 23:21

5
379
0

Báo cáo y học: " Systemic lupus erythematosus associated with type 4 renal tubular acidosis: a case report and review of the literatur" pps

Ngày tải lên : 11/08/2014, 00:23

5
509
0

báo cáo khoa học: " Systems medicine and the integration of bioinformatic tools for the diagnosis of Alzheimer’s disease" doc

Ngày tải lên : 11/08/2014, 12:21

5
311
0

Báo cáo y học: "Systematic review: The relation between nutrition and nosocomial pneumonia: randomized trials in critically ill patients" doc

Ngày tải lên : 12/08/2014, 18:20

8
446
0

Báo cáo y học: "Systematic review: Intra-aortic balloon counterpulsation pump therapy: a critical appraisal of the evidence for patients with acute myocardial infarction" doc

Ngày tải lên : 12/08/2014, 18:20

6
575
0

Báo cáo y học: "Systemic and local eosinophil inflammation during the birch pollen season in allergic patients with predominant rhinitis or asthma" ppt

Ngày tải lên : 13/08/2014, 13:22

8
294
0

Báo cáo y học: "Systematic analysis of transcribed loci in ENCODE regions using RACE sequencing reveals extensive transcription in the human genome" pptx

Ngày tải lên : 14/08/2014, 08:20

14
253
0

Báo cáo y học: "Systems biology-defined NF-κB regulons, interacting signal pathways and networks are implicated in the malignant phenotype of head and neck cancer cell lines differing in p53 status" pps

Ngày tải lên : 14/08/2014, 08:20

22
434
0

Báo cáo y học: " Systemic analysis of the response of Aspergillus niger to ambient pH" ppt

Ngày tải lên : 14/08/2014, 21:20

14
293
0

Báo cáo thẻ điểm quản trị công ty

Ngày tải lên : 23/01/2013, 11:06

... Ngành chăm sóc sức khỏe, bao gồm dịch vụ trang thiết bị y tế, sản xuất dược phNm công nghệ sinh học, đạt điểm số chung cao Điểm số giá trị trung bình nhóm ngành 50.4%, điểm số cao 60.9% Nhóm ngành ... nâng cao niềm tin nhà đầu tư, thu hút đầu tư nước vào Việt Nam giảm chi phí vốn cho công ty Rà soát Quản trị Công ty nghiên cứu tìm hiểu việc tuân thủ luật lệ quy định quản trị công ty, bao gồm ... trường chứng khoán theo hướng ngày phù hợp với thông lệ tiêu chuNn quốc tế quản trị công ty, UBCKNN hợp tác chặt chẽ với tổ chức quốc tế việc phát triển thị trường chứng khoán theo hướng minh bạch...

23
469
4

Báo cáo thế giới về thương tích cho trẻ em

Ngày tải lên : 20/03/2013, 15:38

... B.1 (TIẾP THEO) Quảng tây, Trung quốc Các bé trai (tuổi theo năm) Các bé gái (tuổi theo năm)

45
697
1