... say, ten candidate translations to help the translator We obtained the evaluations of three h u m a < /b> n judges (El-E3) Evaluator E1 is a < /b> native Cantonese speaker, E2 a < /b> Mandarin speaker, and < /b> E3 a < /b> ... need a < /b> priori information Since EM-based word alignment algorithms using random initialization can fall into local maxima, our output can also be used to provide a < /b> better initializing basis for < /b> ... generalize to Asian languages? In Pro- ceedings of Pacific Asia Conference on Formal and < /b> Computational Linguistics CHURCH, KENNETH 1993 Char_align: A < /b> program for < /b> aligning parallel texts at the character...
... accountant and < /b> an advisor Can I get a < /b> loan from any of these new programs? SBA loan programs are available to start-up businesses as well as those that are already established All applicants must ... qualify for < /b> a < /b> SBA 7 (a)< /b> loan, borrowers must be unable to secure conventional commercial financing on reasonable terms and < /b> be a < /b> “small business” as defined by SBA size standards In 2008, of the $18 billion ... small business I have only been in business for < /b> two years and < /b> don’t have three years of financial statements or business history Can I get a < /b> loan? Yes, you may qualify for < /b> a < /b> loan SBA loan guarantee...
... be a < /b> uniformly convex Banach space, C be a < /b> nonempty closed convex subset of E, and < /b> S : C ® C be a < /b> nonexpansive mapping Then I - S is demi-closed at zero Kangtunyakarn Fixed Point Theory and < /b> Applications ... Kangtunykarn and < /b> Suantai [5] introduced the S-mapping generated by a < /b> finite family of nonexpansive mappings and < /b> real numbers as follows: Definition 2.1 Let C be a < /b> nonempty convex subset of real ... generality, we may assume that {xn j } converses weakly to some q < /b> Î H By nonexpansiveness of S and < /b> K, (3.20) and < /b> Lemma 2.3, we have that Q < /b> is nonexpansive mapping and < /b> F (Q)< /b> = F(K) F(S) (3:25) Kangtunyakarn...
... Combettes and < /b> S A < /b> Hirstoaga, “Equilibrium programming in Hilbert spaces,” Journal of Nonlinear and < /b> Convex Analysis, vol 6, no 1, pp 117–136, 2005 A < /b> Moudafi and < /b> M Th´ ra, “Proximal and < /b> dynamical approaches ... S Takahashi and < /b> W Takahashi, “Strong convergence theorem for < /b> a < /b> generalized equilibrium problem and < /b> a < /b> nonexpansive mapping in a < /b> Hilbert space,” Nonlinear Analysis: Theory, Methods & Applications, ... integrals,” Journal of Mathematical Analysis and < /b> Applications, vol 305, no 1, pp 227–239, 2005 18 A < /b> Kangtunyakarn and < /b> S Suantai, “Hybrid iterative scheme for < /b> generalized equilibrium problems and < /b> fixed...
... of two variational inequalities VI C ,A < /b> and < /b> VI C ,B PC ; solution of a < /b> system of two mixed equilibrium problems Tn Trn and < /b> Vn solution of a < /b> mixed equilibrium problem and < /b> a < /b> variational inequality ... Chadli, Z Chbani, and < /b> H Riahi, “Equilibrium problems with generalized monotone bifunctions and < /b> applications to variational inequalities,” Journal of Optimization Theory and < /b> Applications, vol ... bifunctions and < /b> equilibrium problems,” Journal of Optimization Theory and < /b> Applications, vol 90, no 1, pp 31–43, 1996 24 E Blum and < /b> W Oettli, “From optimization and < /b> variational inequalities to equilibrium...
... sphere is subtle Heaven (Brahma-Loka); and < /b> whose archetypal analyst is Kirpal Singh (7) The causal level of ultimate exchange, whose paradigm is radical absorption in and < /b> as the Uncreate (samadhi); ... Spread 23 23 24 Karmic Tarot How the Major and < /b> Minor Arcana Interact The Karmic Spread is a < /b> structure that accommodates and < /b> uses information generated by the karma at work in an individual’s ... passive and < /b> active; passive in the emotional and < /b> spiritual planes in order to listen and < /b> receive information, and < /b> active in the physical and < /b> mental planes in order to validate and < /b> interpret all...
... Extraction based solution has low scalability and < /b> low adaptability while Text Information Retrieval based solution has high scalability but low adaptability As a < /b> result, another approach has been ... numeric attribute can have a < /b> range constraint and < /b> a < /b> text attribute can be either a < /b> term or a < /b> phrase Example 2: An object query for < /b> “an apartment in Cau Giay at least 100 m2 and < /b> at most billion VND” ... S Jayram, Rajasekar Krishna-murthy, Sriram Raghavan, Shivakumar Vaithyanathan, and < /b> Huaiyu Zhu Avatar information extraction system IEEE Data Eng Bull [23] Sándor Dominich The Modern Algebra of...
... drawn payable at a < /b> fixed period after sight, the drawer may prohibit presentment for < /b> acceptance He may al so stipulate that presentment for < /b> acceptance 75 shall not take place before a < /b> named date ... exchange may be drawn payable: 110 At sight; 111 At a < /b> fixed period after sight; 112 At a < /b> fixed period after date; 113 At a < /b> fixed date 114 Bills of exchange at other maturities or payable by 115 ... periods may be abridged by the endorsers The drawer may prescribe that a < /b> bill of exchange 118 payable at sight must not be presented for < /b> payment before a < /b> named date In this case, the period for < /b> presentation...
... ®nding a < /b> job, about unemployment and < /b> job security, about skill obsolescence and < /b> job injury, about making ends meet with a < /b> paycheck To say that members of a < /b> class share common class interests means ... ®rst explain limitation and < /b> transformation Figure 10.3 illustrates the general abstract relation between limitation and < /b> transformation: structures impose limits on practices; practices transform ... (especially small farmers in the American case) Class practices Class practices are activities engaged in by members of a < /b> class using class capacities in order to realize at least some of their class...
... misunderstanding the figurative meaning At advanced level, comparative form could be translated in a < /b> literal way, for < /b> instance: as analyzing semantic mechanisms of idioms should be done so that lovely ... Vietnamese also owns some typical idioms containing TsFPs under In Vietnamese the form of noun phrases Normally, they have a < /b> parallel structure root and < /b> branch, salad days, b i b nương dâu, ba < /b> rau ... 24 negative, neutral effect), human situations and < /b> conditions (favorable Secondly, teaching the history of how an idiom came into and < /b> unfavorable), human relationship and < /b> human social status…...
... 4.00 Q:< /b> Setting proper backlash in a < /b> tolerance critical application? A:< /b> Ball screw assemblies can be provided with standard back lash, minimal back lash, or preload Preloading of a < /b> ball screw affects ... not change The load capacity of a < /b> ball screw is calculated based on the life of the ball bearing and < /b> the materials of construction Better materials, larger components, larger ball bearings, and < /b> ... seals to retain the grease in the ball screw housing? A:< /b> Wipers are available as standard or optional on most ball nuts Q:< /b> Are Sealeze brushes are adequate? A:< /b> The precision inch series of ball...
... Dim odaDisplay As OleDb.OleDbDataAdapter Dim dtDisplay As New DataTable() Try ' Take the txtSQLString text and < /b> create a < /b> data table Then set the ' data source of the data grid odaDisplay = New ... Setting DOCUMENT bgColor buttonface Label Name Label1 Text Tables Name Label2 Text Columns Name Label3 Text SQL String Name Label4 Text Data Display Name lstTables AutoPostback True Name lstColumns ... "Northwind")) Dim ocmdTables As New OleDb.OleDbCommand("sp_Tables", ocnn) Dim odrTables As OleDb.OleDbDataReader ' Specify the type of command being performed ocmdTables.CommandType = CommandType.StoredProcedure...
... Private Sub btnView_Click(ByVal sender As System.Object, _ ByVal e As System.EventArgs) Handles btnView.Click Dim odaDisplay As OleDb.OleDbDataAdapter Dim dtDisplay As New DataTable() Try ' Take the ... use Dim ocmdTables As New OleDb.OleDbCommand("sp_Tables", mcnn) Dim odrTables As OleDb.OleDbDataReader Try ' Specify the type of command being performed ocmdTables.CommandType = CommandType.StoredProcedure ... txtSQLString text and < /b> create a < /b> data table; then set the ' data source of the data grid odaDisplay = New OleDb.OleDbDataAdapter(Me.txtSQLString.Text, mcnn) odaDisplay.Fill(dtDisplay) Me.dgDisplay.DataSource...
... microRNAs and < /b> Arabidopsis development [24,25] Arabidopsis TEBICHI, containing an N-terminal DELH box RNA helicase domain and < /b> a < /b> C-terminal DNA polymerase I domain, was shown to be required for < /b> the ... Floral dip: a < /b> simplified method for < /b> Agrobacterium-mediated transformation of Arabidopsis thaliana Plant J 16, 735–743 60 Jefferson RA, Kavanagh TA & Bevan MW (1987) GUS fusions: beta-glucuronidase ... box RNA helicase R.-R Xu et al use Total RNA was isolated from different A < /b> thaliana seedlings with Trizol reagent (Invitrogen, Carlsbad, CA, USA) Quantitative real-time PCR analysis Total RNA...
... entered into the analyses as linear variables The association between daily levels of traffic-related air pollutants and < /b> ER attendance for < /b> respiratory causes was analysed by a < /b> conditional logistic ... (missing) Table Statistics for < /b> urban air pollutant, weather variables, and < /b> distribution of the absolute differences between the daily levels of each pollutant ("event days”) and < /b> the average concentrations ... selected air pollutants and < /b> were adjusted for < /b> meteo-climatic parameters, and < /b> influenza epidemic peaks (see Methods - Statistical analysis) bFor < /b> an increase of mg/m3 a < /b> Tramuto et al Environmental Health...
... and < /b> AFQT 29 Table 4.2 Group Troubleshooting and < /b> AFQT, AIT Graduates 29 Table 4.3 AFQT and < /b> Patriot Air Defense System Operator Performance, Probabilities of Success 31 Table 4.4 AFQT and < /b> Patriot ... Comments are welcome and < /b> may be addressed to Jennifer Kavanagh, RAND Corporation, 1776 Main Street, Santa Monica, California 90407, or Jennifer_Kavanagh@rand.org For < /b> more information on RAND's Forces ... Previous Week and < /b> Bombing Error .20 Table 3.5 Career Training Hours and < /b> Air-to-Air Combat Performance 21 Table 3.6 Copilot Career Training and < /b> Tactical Drop Error 22 Table 3.7 Navigator Training Hours...
... substantial The availability of financial resources and < /b> lack of capacity to handle complex business management issues as well as a < /b> complicated and < /b> bureaucratic environment present major obstacles ... exchange and < /b> transfer of ideas both within and < /b> outside the country; • Create awareness of what central government can and < /b> cannot and < /b> what needs to be done at the local and < /b> regional level; • Enable ... legal and < /b> tax information Marketing advice Guidance on labour law, insurance, customs, etc In-depth legal support, e.g arbitration Standards advice Tax advice Fairs, exhibitions Documentation and...
... CTGTACATCAAGGA; alpha smooth muscle actin (a-< /b> SMA): AGCCAGTCGCCATCAGGAAC and < /b> CCGG AGCCATTGTCACACAC; and < /b> glyceraldehyde-3-phosphate dehydrogenase: 5¢-GGCACAGTCAAGGCTGAGAATG-3¢ and < /b> 5¢-ATGGTGGTGAAGACGCCAGTA-3¢ ... CACCAGTTGGTTGTCTTTGA-3¢; IL-10: 5¢-CAGACCC ACATGCTCCGAGA-3¢ and < /b> 5¢-CAAGGCTTGGCAA CCCAAGTA-3¢; collagen I: TCCTGGCAATCGTGGTT CAA and < /b> ACCAGCTGGGCCAACATTTC; collagen III: TGGACAGATGCTGGTGCTGAG and < /b> GAAGGCCAG 3696 ... Hypoxia ⁄ SD induces NF-jB-dependent IL- 1b and < /b> TNF -a < /b> transcription Because transcription of IL- 1b and < /b> TNF -a < /b> can be augmented in MSCs by hypoxia [5], and < /b> because the molecular masss of IL- 1b and...
... graphical, textual and < /b> vocal feedback tions compared to others, language use must be encouraged without being forced, and < /b> finding this balance can be very hard to achieve in practice Design and < /b> ... implementation The dialogue manager contains only linguistic knowledge and < /b> interaction algorithms Domain knowledge is stored in an SQL database and < /b> is accessed by the dialogue manager based on ... the form of sets of semantic pairs A < /b> semantic pair (SP) is a < /b> qualified piece of information that the dia50 logue system is able to understand For < /b> example, a < /b> system could understand semantic pairs...
... probabilities or Jaso transition probabilities for < /b> spelling error correction for < /b> Korean We choose Jaso transition probabilities because there are several advantages Since an Eumjeol is a < /b> combination ... N-gram A < /b> is obtained from only training corpus and < /b> n-gram B is obtained from all training and < /b> test corpora All accuracies are measured based on Eojeol unit Table shows the results of word spacing ... spaces As shown above, the performance is dependent of the language model (n-gram) performance Jaso transition probabilities can be obtained easily from small corpus because the number of Jaso...