backup with rman backup piece in a nondefault location

... categories are shown as means with ranges where appropriate Comparative data between characteristics are displayed, and data are summarized as tables as well as in text Results Patient characteristics ... awareness King Fahad National Guard Hospital is an 800-bed tertiary care hospital located in the central region of the Kingdom of Saudi Arabia (KSA), provides multilevel health care for National Guard ... mechanical ventilation It is probable that debilitating factors such as alcoholism or anemia are contributory Aspiration of sputum leading to aspiration pneumonia was a less common diagnosis in...

Ngày tải lên: 15/02/2014, 12:20

... Sottrup-Jensen L, Aspan A, Hall M & Soder¨ hall K (1997) Pacifastin, a novel 155-kDa heterodimeric proteinase inhibitor containing a unique transferrin chain Proc Natl Acad Sci USA 94, 6682–6687 ... calculated according to the procedures described by Wishart et al [37,38] Fitting of relaxation and dynamical parameters Fitting of R1 and R2 rates and calculating heteronuclear NOE values was ... residues assignable in all three states are compared Weights are calculated as for Fig On average, changes upon pH elevation are about twice as small as for complexation (average change 0.09...

Ngày tải lên: 23/03/2014, 10:21

... including local inflammation, injection site pain and itching, anaphylaxis/anaphylactoid reactions, local ecchymosis, nausea/vomiting, diarrhea, anorexia, and headache [26] While Hyalgan © has ... demonstrating dysplastic hips with shallow, horizontal acetabula, post-traumatic bowing, Arrow indicates healing tibial fracture Diaphyses are gracile with thin cortices and obliterated medullae, in ... alternative for a patient with Marshall Smith Syndrome and debilitating, painful bilateral hip dysplasias using intra-articular sodium hyaluronate injections This management option should be Salter...

Ngày tải lên: 20/06/2014, 04:20

... including local inflammation, injection site pain and itching, anaphylaxis/anaphylactoid reactions, local ecchymosis, nausea/vomiting, diarrhea, anorexia, and headache [26] While Hyalgan © has ... demonstrating dysplastic hips with shallow, horizontal acetabula, post-traumatic bowing, Arrow indicates healing tibial fracture Diaphyses are gracile with thin cortices and obliterated medullae, in ... alternative for a patient with Marshall Smith Syndrome and debilitating, painful bilateral hip dysplasias using intra-articular sodium hyaluronate injections This management option should be Salter...

Ngày tải lên: 20/06/2014, 07:20

... increases, the hardware complexity of a transform as well as the compression latency also increases Another approach is a spatial domain FMC that requires a relatively small amount of computation ... image in this case is in the : : format instead of the : : format as in Section Thus, all three color components are available for each pixel, and they are packetized in the same format shown in ... represent an image In general, the three color components are stored in separate spaces in frame memory One reason for separate memory allocation is because the three components are not always accessed...

Ngày tải lên: 21/06/2014, 19:20

... rehabilitation programme [in Modern Greek] Pneumonologika Themata 2006:21-23 38 Mishima M, Oku Y, Muro S, Hirai T, Chin K, Ohi M, Nakagawa M, Fujita M, Sato K, Shimada K, Yamaoka S, Oda Y, Asai ... depression and anxiety in patients with COPD: relationship to functional capacity Chest 1985, 87:35-38 15 Maurer J, Rebbapragada V, Borson S, Goldstein R, Kunik M, Yohannes AM, Hanania NA: Anxiety and ... disease They frequently have to change jobs or retire early Their social interactions are also adversely affected because they cannot maintain pace with their peers [37] In addition, patients with...

Ngày tải lên: 08/08/2014, 23:21

... Oncologia, Ospedale Cardarelli, Napoli, Italy 2UOC Chirurgia Toracica, Ospedale Cardarelli, Napoli, Italy 3UOC Anatomia Patologica, Ospedale Cardarelli, Napoli, Italy Authors’ contributions FR, GDL and ... regimen in advanced non-small-cell lung cancer: a meta-analysis JAMA 2004, 292:470-84 Mattson KV, Abratt RP, ten Velde G, Krofta K: Docetaxel as neoadjuvant therapy for radically treatable stage ... docetaxel-based chemotherapy in other inoperable malignant tumors, such as breast cancer[8] Surprisingly, a complete pathologic response was not obtained with a platinum-based regimen, but with single-agent...

Ngày tải lên: 09/08/2014, 03:21

... in a patient with prosthetic aortic valve infective endocarditis: a case report Vishal Luther1*, Refai Showkathali2 and Reto Gamma2 Abstract Introduction: Acute ST-segment elevation myocardial ... following aortic and mitral valve replacement: successful management with abciximab and urokinase Cathet Cardiovasc Diagn 1998, 43:457-459 Kiernan TJ, Flynn AMO, Kearney P: Coronary embolism causing ... embolisation is a rare cause of AMI and needs to be considered in patients with atrial fibrillation, Figure Echocardiogram (apical view) showing vegetation in the native posterior mitral valve leaflet...

Ngày tải lên: 10/08/2014, 23:20

... wall was thin and a fetal hand and head were visible through it (Figure 2A and 2B) A transverse incision was made cephalad to this thin wall area, and a 2604 g (appropriate-for-date Figure An abdominal ... important clinical issue is that abdominal palpation and ultrasound may be useful in detecting this condition Although abdominal pain [2,3] and non-reassuring FHR patterns, especially fetal bradycardia, ... posterior incarceration A histological examination of the excised uterine wall was not performed An abdominal and vaginal ultrasound seven days post-partum revealed a well-involuted uterus and the absence...

Ngày tải lên: 11/08/2014, 03:20

... murmur radiating to the apex and to the carotid arteries An abdominal examination revealed a distended abdomen and tenderness to palpation in the left upper quadrant A computed tomography (CT) scan ... consistent with acquired systemic AA amyloidosis, which was previously called Figure Hematoxylin and eosin staining results Hematoxylin and eosin stain of splenic tissue at 40 × magnification showing amyloid ... from systemic AA amyloidosis Conclusion Patients with a history of ‘skin popping’, especially with black tar heroin, are at risk for AA amyloidosis In patients with chronic inflammatory conditions...

Ngày tải lên: 11/08/2014, 03:20

... life-threatening complication of PEG-IFNa 2a treatment Abbreviations AA: aplastic anemia; AIHA: autoimmune hemolytic anemia; EBV: Epstein-Barr virus; HAA: hepatitis-associated aplastic anemia; Hb: ... tissue and its replacement with fat Hematoxylin & eosin staining 20× magnification The diagnosis of severe AA was made in the patient Treatment with PEG-IFN -a 2a and ribavirin were discontinued ... doi:10.1186/1752-1947-4-268 Cite this article as: Ioannou et al.: Aplastic anemia associated with interferon alpha 2a in a patient with chronic hepatitis C virus infection: a case report Journal of Medical Case Reports...

Ngày tải lên: 11/08/2014, 03:21

... FDAapproved drugs on the market for the treatment of RLS Now ropinirole and pramipexole, both dopamine agonists, are available Unfortunately these drugs can cause insomnia, nausea, dyspepsia, and ... this case report Anodyne was used, but there are other similar devices available for healthcare providers Anodyne is FDA approved for increasing circulation and reducing pain, and it has been ... Pathophysiology, and Pharmacology Pharmacol Rev 1991, 43(2):109-142 23 Hawkins D, Abrahamse H: Phototherapy - a treatment modality for wound healing and pain relief African Journal of Biomedical Research 2007,...

Ngày tải lên: 11/08/2014, 03:21

... FDAapproved drugs on the market for the treatment of RLS Now ropinirole and pramipexole, both dopamine agonists, are available Unfortunately these drugs can cause insomnia, nausea, dyspepsia, and ... this case report Anodyne was used, but there are other similar devices available for healthcare providers Anodyne is FDA approved for increasing circulation and reducing pain, and it has been ... Pathophysiology, and Pharmacology Pharmacol Rev 1991, 43(2):109-142 23 Hawkins D, Abrahamse H: Phototherapy - a treatment modality for wound healing and pain relief African Journal of Biomedical Research 2007,...

Ngày tải lên: 11/08/2014, 07:20

... in 2004 and had been taking warfarin but had discontinued the medication Medical examination revealed blood pressure of 130/70mmHg and heart rate of 85 beats/minute and the patient was pale and ... 1993, 11:183-186 Kawakami Y, Nakayama Y, Nagao H, Hirota Y, Kawamura K: A case of Behcet's disease complicated with acute myocardial infarction Kokyu To Junkan 1991, 39:935-938 [Japanese] Le Thi ... literature, several different therapeutic approaches have been advanced for the management of myocardial infarction in patients with BD These may include primary percutaneous transluminal coronary...

Ngày tải lên: 11/08/2014, 14:20

... TCGACGTGTCGAAGTGAAAG; AtpA1170R: TCTGAGCCAAATTGAGCAAA) DNA nucleotide sequences of the cox1 and atp1 coding regions were determined for the maternal plants and a few representative progeny from each family ... with an extra band as intense as the major bands were found among 39 siblings in the Kov45 family and 20 individuals with an extra band slightly fainter than the major bands were found among ... study Within-sibship variation was attributable to paternal inheritance, lineage sorting or maybe to the rearrangement of mt DNA by recombination Our Page of 11 results demonstrate that transcription...

Ngày tải lên: 12/08/2014, 03:21

... this paper is that if the optimal base stock order-up-to point is attainable in any period, then it will be attainable in all remaining periods Tagaras and Cohen [45] took the deterministic lead ... effort into account They showed that buy-back contract alone cannot coordinate the supply chain They also proposed several alternative contracts resulting in coordination Cachon [14] analyzed a supply ... batch transfer with setup cost 2.2 Supply Chain Coordination Another stream of research is about supply chain coordination We categorize the literature in supply chain coordination according to...

Ngày tải lên: 08/11/2015, 16:45

... the imaging probe was placed either against the skin or at a distance from the skin in water for pre-treatment imaging The integrated transducer was mounted in a degassed water reservoir with ... ear veins and ketamine was infused (50 mg/h) for anesthesia Diazepam was administered as needed The HIFU ablation procedure complies with the guidance of the National Standard of China and was described ... procedure At day 7, the animals were sacrificed, and the whole pancreas was removed for histological examination Histological examination The pancreas was stained with 1% 2,3,5-triphenyltetrazolium...

Ngày tải lên: 25/10/2012, 11:18

... End Points and Definitions The primary clinical efficacy end points included major adverse cardiac events (MACE) at two year (MACE: Death, myocardial infarction, target vessel revascularization ... procedure, a bolus dose of unfractionated heparin (100 U/kg) was injected through the femoral or radial artery sheath, with repeated boli administered as needed to maintain activated and clotting time ... these initial trials indicate that the ZES is safe and reduces the rates of clinical and angiographic restenosis in patients with symptomatic coronary artery disease (CAD; 4) Also the safety and...

Ngày tải lên: 25/10/2012, 11:18

... Federation notation), as well as with the presence of an impacted supernumerary tooth (distomolar 4.9) The patient reported localized pain and a slight homolateral submandibular lymphadenopathy, without ... J Clin Pediatr Dent 1997;21(3):205-11 Prabhu NT, Munshi AK Surgical management of a labially placed permanent maxillary central incisor after supernumerary tooth extraction: report of a case ... hematological investigation and after the assessment of 380 radiographic exams, such as X-Ray Dental Panoramic Tomogram and Denta-Scan (Fig 6) of the inferior maxillary bone Exodontia led to remission...

Ngày tải lên: 25/10/2012, 11:40

... coronary artery binding graft; CK: creatine kinase; MACE: major adverse cardiac events; MI: myocardial infarction; PES: paclitaxel-eluting stent; RESEARCH: Rapamycin-Eluting Stent Evaluated at Rotterdam ... adverse cardiac events (MACE), including cardiac death, myocardial infarction (MI), and target vessel revascularization (TVR) MI was defined as the elevation of creatine kinase (CK) > times above ... achieve maximal vasodilatation The use of glycoprotein IIb/IIIa inhibitor (Tirofiban) was at the operator’s discretion All patients maintained antiplatelet therapy after the procedure (aspirin...

Ngày tải lên: 26/10/2012, 08:57